Previous Contig 010883:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049C13Sequence512002103 (6)pir|B84420|B844205e-12transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A296010883 (2)
JMSF021L22Sequence667002103 (6)pir|B84420|B844202e-24transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A769010883 (2)pir|B84420|B844201e-20transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021L22+ TGTGC
                      ____________________________________________________________
consensus TGTGC
 
. : . : . : . : . : . :
rJMSF021L22+ AAGGGCTGACAATTATCATGTAAAAAGCCATTTACAGCATCCAGAAATATCGACTTTCCA
                      ____________________________________________________________
consensus AAGGGCTGACAATTATCATGTAAAAAGCCATTTACAGCATCCAGAAATATCGACTTTCCA
 
. : . : . : . : . : . :
rJMSF021L22+ AATACCTTCCCGATGCATCATCTGATGGAAAAAAACCCGACAAGAAAGATTCAAGTGATA
                      ____________________________________________________________
consensus AATACCTTCCCGATGCATCATCTGATGGAAAAAAACCCGACAAGAAAGATTCAAGTGATA
 
. : . : . : . : . : . :
rJMSF021L22+ TAATCTCCGGCCTAGATGATTCATCTGGAATGCAAATAACTGAGGCACTAAAATTGCAGA
                      ____________________________________________________________
consensus TAATCTCCGGCCTAGATGATTCATCTGGAATGCAAATAACTGAGGCACTAAAATTGCAGA
 
. : . : . : . : . : . :
rJMSF021L22+ TGGAGGTCCAAAAGCGCCTACACGAGCAACTAGAGGTTCAGCGCCAGCTACAGCTAAGGA
                      ____________________________________________________________
consensus TGGAGGTCCAAAAGCGCCTACACGAGCAACTAGAGGTTCAGCGCCAGCTACAGCTAAGGA
 
. : . : . : . : . : . :
rJMSF021L22+ TAGAGGCCCAAGGCAAGTATTTGAAGAAGATAATAGAAGAACAACAGCAACTCGAAATGC
                      ____________________________________________________________
consensus TAGAGGCCCAAGGCAAGTATTTGAAGAAGATAATAGAAGAACAACAGCAACTCGAAATGC
 
. : . : . : . : . : . :
rJMSF021L22+ CAGAGTCCTCTGGGGCTACGTCTGCATCAGCAGGCGAGAATGCCCCGGTATCTGATAACA
                      ____________________________________________________________
consensus CAGAGTCCTCTGGGGCTACGTCTGCATCAGCAGGCGAGAATGCCCCGGTATCTGATAACA
 
. : . : . : . : . : . :
rJMSF021L22+ GTACAAATCCAGTGACGCCTGTACCTGCATCTGAAAAGCCTGAAAACGAACAACGCAATC
                      ____________________________________________________________
consensus GTACAAATCCAGTGACGCCTGTACCTGCATCTGAAAAGCCTGAAAACGAACAACGCAATC
 
. : . : . : . : . : . :
rJMSF021L22+ CAGTTAAGGGCATTTCGCTTAATGCCTCGCCATCTTCTCATAACGAGGCTCTTTCACCAG
                      ____________________________________________________________
consensus CAGTTAAGGGCATTTCGCTTAATGCCTCGCCATCTTCTCATAACGAGGCTCTTTCACCAG
 
. : . : . : . : . : . :
rJMSF021L22+ ATTCCAGCTGCCCTGCAGTCGAGAGGCCATCAAAGAAGCAAAAAGTTAGCGCAGAAGCTG
                      ____________________________________________________________
consensus ATTCCAGCTGCCCTGCAGTCGAGAGGCCATCAAAGAAGCAAAAAGTTAGCGCAGAAGCTG
 
. : . : . : . : . : . :
rJMSF021L22+ CTGCGTTTACCCAACCTGATGCAATGCTTACTAAGTTACTTGGCTGAAGCTTGACAAGTC
rJMFF049C13+ CGTTTACCCAACCTGATGCAATGCTTAGTAAGTTACTTGGCTGAAGCTTGACAAGTC
                      ____________________________________________________________
consensus CTGCGTTTACCCAACCTGATGCAATGCTTAGTAAGTTACTTGGCTGAAGCTTGACAAGTC
 
. : . : . : . : . : . :
rJMSF021L22+ ATCAGATCAGAGCGAGAGTTTCAGGTTGGCAAGTTTTACGTTTTTTATGTGTAACATTAA
rJMFF049C13+ ATCAGATCAGAGCGAGAGTTTCAGGTTGGCAAGTTTTACGTTTTTTATGTGTAACATTAA
                      ____________________________________________________________
consensus ATCAGATCAGAGCGAGAGTTTCAGGTTGGCAAGTTTTACGTTTTTTATGTGTAACATTAA
 
. : . : . : . : . : . :
rJMSF021L22+ TAGTTAAAACAGGGTTTGATTAGGACATAGAAACTGCTTGCTTCTTAAATGTGTGTTGCC
rJMFF049C13+ TAGTTAAAACAGGGTTTGATTAGGACATAGAAACTGCTTGCTTCTTAAATGTGTGTTGCC
                      ____________________________________________________________
consensus TAGTTAAAACAGGGTTTGATTAGGACATAGAAACTGCTTGCTTCTTAAATGTGTGTTGCC
 
. : . : . : . : . : . :
rJMSF021L22+ TTGGTTCACTCATCTTAATTTAGTACCCAGTTGCTTAAACTTT
rJMFF049C13+ TTGGTTCACTCATCTTAATTTAGTA-CCAGTTGCTTAAACTTTTGCCTAATGCTAAATAA
                      ____________________________________________________________
consensus TTGGTTCACTCATCTTAATTTAGTACCCAGTTGCTTAAACTTTTGCCTAATGCTAAATAA
 
. : . : . : . : . : . :
rJMFF049C13+ AAATGTGAATTATACTGCCTAAAAAAAAAAAAAAGAAAAAAAAAAAAAACGCTCCAGGGT
                      ____________________________________________________________
consensus AAATGTGAATTATACTGCCTAAAAAAAAAAAAAAGAAAAAAAAAAAAAACGCTCCAGGGT