Previous Contig 010880:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017A05Sequence540010880 (6)gb:BT005248_16381884e-51Arabidopsis thaliana At1g18800 mRNA, complete cds.>gb:AK118024_1816026 Arabidops772010880 (6)pir|H86321|H863217e-52hypothetical protein F6A14.10 [imported] - Arabidopsis thaliana>gb:AE005172_8908
JMFF049C01Sequence519010880 (6)gb:BT005248_16381881e-48Arabidopsis thaliana At1g18800 mRNA, complete cds.>gb:AK118024_1816026 Arabidops449010880 (6)pir|G96774|G967742e-05hypothetical protein F1M20.24 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMSF015G21Sequence437010880 (6)gb:BT005248_16381881e-44Arabidopsis thaliana At1g18800 mRNA, complete cds.>gb:AK118024_1816026 Arabidops666010880 (6)pir|H86321|H863215e-33hypothetical protein F6A14.10 [imported] - Arabidopsis thaliana>gb:AE005172_8908

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049C01- GCGAGTTTGTGTCGATATAAACGCAGGCGAAGGAGGGTTTAGGGTT
JMFF017A05- GTCTTTTGTCGCGAGTTTGTGTCGATATAAACGCAGGCGAAGGAGGGTTTAGGGTT
                      ____________________________________________________________
consensus GTCTTTTGTCGCGAGTTTGTGTCGATATAAACGCAGGCGAAGGAGGGTTTAGGGTT
 
. : . : . : . : . : . :
JMFF049C01- TAAGCCTCTCCCTGAGTCCCAGCTCTAAACAGAAGTAGAAGAAGAACAACAACAAGAAGA
JMSF015G21- AAGCCTCTCCCTGAGTCCCAGCTCTAAACAGAAGTAGAAGAAGAACAACAACAAGAAGA
JMFF017A05- TAAGCCTCTCCCTGAGTCCCAGCTCTAAACAGAAGTAGAAGAAGAACAACAACAAGAAGA
                      ____________________________________________________________
consensus TAAGCCTCTCCCTGAGTCCCAGCTCTAAACAGAAGTAGAAGAAGAACAACAACAAGAAGA
 
. : . : . : . : . : . :
JMFF049C01- AAATGGTGGCGGATAAAGGGAAGAAGCAGAAGGTGGAAGAGAAAGAGGAAAACCACATTG
JMSF015G21- AAATGGTGGCGGATAAAGGGAAGAAGCAGAAGGTGGAAGAGAAAGAGGAAAACCACATTG
JMFF017A05- AAATGGTGGCGGATAAAGGGAAGAAGCAGAAGGTGGAAGAGAAAGAGGAAAACCACATTG
                      ____________________________________________________________
consensus AAATGGTGGCGGATAAAGGGAAGAAGCAGAAGGTGGAAGAGAAAGAGGAAAACCACATTG
 
. : . : . : . : . : . :
JMFF049C01- ACAAAGAGCTTGTCCTATCAATCGAAAAACTTCAAGAGATCCAAGATGAGCTCGAAAAGA
JMSF015G21- ACAAAGAGCTTGTCCTATCAATCGAAAAACTTCAAGAGATCCAAGATGAGCTCGAAAAGA
JMFF017A05- ACAAAGAGCTTGTCCTATCAATCGAAAAACTTCAAGAGATCCAAGATGAGCTCGAAAAGA
                      ____________________________________________________________
consensus ACAAAGAGCTTGTCCTATCAATCGAAAAACTTCAAGAGATCCAAGATGAGCTCGAAAAGA
 
. : . : . : . : . : . :
JMFF049C01- TCAATGAAGAAGCAAGTGATAAGGTTTTGGAAGTAGAGCAAAAGTATAGTGAGATACGCA
JMSF015G21- CCAATGAAGAAGCAAGTGATAAGGTTTTGGAAGTAGAGCAAAAGTATAGTGAGATACGCA
JMFF017A05- TCAATGAAGAAGCAAGTGATAAGGTTTTGGAAGTAGAGCAAAAGTATAGTGAGATACGCA
                      ____________________________________________________________
consensus TCAATGAAGAAGCAAGTGATAAGGTTTTGGAAGTAGAGCAAAAGTATAGTGAGATACGCA
 
. : . : . : . : . : . :
JMFF049C01- AGCCTGTCTACCAGAAGCGAAATGACATAATTAAATCTATTCCAGATTTTTGGTTGACAG
JMSF015G21- AGCCTGTCTACCAGAAGCGAAATGACATAATTAAATCTATTCCAGATTTTTGGTTGACAG
JMFF017A05- AGCCTGTCTACCAGAAGCGAAATGACATAATTAAATCTATTCCAGATTTTTGGTTGACAG
rJMFF017A05+ GTTGACAG
                      ____________________________________________________________
consensus AGCCTGTCTACCAGAAGCGAAATGACATAATTAAATCTATTCCAGATTTTTGGTTGACAG
 
. : . : . : . : . : . :
JMFF049C01- CTTTTTTGAGTCATCCAGTCCTTAGTGAACTTTTGACTGAAGAGGACCAAAAGATTTTCA
JMSF015G21- CTTTTTTGAGTCATCCAGTCCTTAGTGAACTTTTGACTGAAGAGGACCAAAAGATTTTCA
JMFF017A05- CTTTTTTGAGTCATCCAGTCCTTAGTGAACTTTTGACTGAAGAGGACCAAAAGATTTTCA
rJMFF017A05+ CTTTTTTGAGTCATCCAGTCCTTAGTGAACTTTTGACTGAAGAGGACCAAAAGATTTTCA
                      ____________________________________________________________
consensus CTTTTTTGAGTCATCCAGTCCTTAGTGAACTTTTGACTGAAGAGGACCAAAAGATTTTCA
 
. : . : . : . : . : . :
JMFF049C01- AGTTTCTGAGTTCCATTGAAGTGGAGGATTCTAAAGACGTCAAATCTGGTTATTCCATCA
JMSF015G21- AGTTTCTGAGTTCCATTGAAGTGGAGGATTCTAAAGACGTCAAATCTGGTTATTCAATCA
JMFF017A05- AGTTTCTGAGTTCCATTGAAGTGGAGGATTCTAAAGACGTCAAATCTGGTTATTCAATCA
rJMSF015G21+ TAAAGACGTCAAATCTGGTTATTCAATCA
rJMFF017A05+ AGTTTNTGAGTTCCATTGAAGTGGAGGATTNTAAAGACGTCAAATCTGGTTATTCAATCA
                      ____________________________________________________________
consensus AGTTTCTGAGTTCCATTGAAGTGGAGGATTCTAAAGACGTCAAATCTGGTTATTCAATCA
 
. : . : . : . : . : . :
JMFF049C01- TATTTAACTTTAAATCCAACCCCTATTTTGAAGATACAA
JMSF015G21- TATTTAACTTTAAATCC
JMFF017A05- TATTTAACTTTAAATCCAACCCCTATTTTGAAGATACAAAGCTCATGAAGAGCTATGCTT
rJMSF015G21+ TATTTAACTTTAAATCCAACCCCTATTTTGAAGATACAAAGCTCATGAAGAGCTNTGCTT
rJMFF017A05+ TATTTAACTTTAAATCCAACCCCTATTTTGAAGATACAAAGCTCATGAAGAGCTATGCTT
                      ____________________________________________________________
consensus TATTTAACTTTAAATCCAACCCCTATTTTGAAGATACAAAGCTCATGAAGAGCTATGCTT
 
. : . : . : . : . : . :
JMFF017A05- TCCA
rJMSF015G21+ TCCAAGAAGAAGGNGCAACNCAAATTACTGCCNCTCCAATCAAATGGAAAGAAGGCNTGC
rJMFF017A05+ TCCAAGAAGAAGGTGCAACNCAAATTNCTGCCNCTCCAATCAAATGGAAAGAAGGCATGC
                      ____________________________________________________________
consensus TCCAAGAAGAAGGTGCAACNCAAATTACTGCCNCTCCAATCAAATGGAAAGAAGGCATGC
 
. : . : . : . : . : . :
rJMSF015G21+ AAATCCCAAATGGAGTTGCTAATGNGAAGAAAGGAAATAAGCGTCCTCCNCCTGAGGAAA
rJMFF017A05+ AAATCCCAAATGGAGTTGCTAATGAGAAGAAAGGAAATAAGCGTCCTCCGCCTGAGGAAA
                      ____________________________________________________________
consensus AAATCCCAAATGGAGTTGCTAATGAGAAGAAAGGAAATAAGCGTCCTCCGCCTGAGGAAA
 
. : . : . : . : . : . :
rJMSF015G21+ GCTTNTTCNCTTGGTTCNGNGAAACCCNACAAAAGGATGAAGATATGGATGNCNTTCNTG
rJMFF017A05+ GCTTNTTCACTTGGTTCAGTGAAACCCAACAAAAGGATGAAGATATGGATGACATTCATG
rJMFF049C01+ AAAAGGATGAAGATATGGATGACATTCATG
                      ____________________________________________________________
consensus GCTTNTTCACTTGGTTCAGTGAAACCCAACAAAAGGATGAAGATATGGATGACATTCATG
 
. : . : . : . : . : . :
rJMSF015G21+ ATGAGGTTGCTGAGTTAATCNGGGNGGACTTATGGCCCGACCCTCTNTNTTACTTCAATA
rJMFF017A05+ ATGAGGTTGCTGAGTTAATCAGGGAGGACTTATGGCCCGACCCTNTNTNTTACTTCAATA
rJMFF049C01+ ATGAGGTTGCTGAGTTAATCAGGGAGGACTTATGGCCCGACCCTCTCTCTTACTTCAATA
                      ____________________________________________________________
consensus ATGAGGTTGCTGAGTTAATCAGGGAGGACTTATGGCCCGACCCTCTCTCTTACTTCAATA
 
. : . : . : . : . : . :
rJMSF015G21+ ATCNGGAAGCTGATGATGAAGAATTTGAGGGTGATGATGAGGAGAAGGGCNGTGATGGGT
rJMFF017A05+ ATCAGGAAGCTGATGATGAAGAATTTGAGGGTGATGATGAGGAGAAGGGCAGTGATGGGT
rJMFF049C01+ ATCAGGAAGCTGATGATGAAGAATTTGAGGGTGATGATGAGGAGAAGGGCAGTGATGGGT
                      ____________________________________________________________
consensus ATCAGGAAGCTGATGATGAAGAATTTGAGGGTGATGATGAGGAGAAGGGCAGTGATGGGT
 
. : . : . : . : . : . :
rJMSF015G21+ NTGAGGATGATGAAGAACNAGATGGCGGTGATGATGACGATGAGGATGGTGATGAAGATG
rJMFF017A05+ NTGAGGATGATGAAGAACAAGATGGCGGTGATGATGACGATGAGGATGGTGATGAAGATG
rJMFF049C01+ CTGAGGATGATGAAGAACAAGATGGCGGTGATGATGACGATGAGGATGGTGATGAAGATG
                      ____________________________________________________________
consensus CTGAGGATGATGAAGAACAAGATGGCGGTGATGATGACGATGAGGATGGTGATGAAGATG
 
. : . : . : . : . : . :
rJMSF015G21+ ACGACTAACTGTTTNTACCNTGTGCTTTTTAGTTTATGAGTTATCCNCNCTTTTGTTTTT
rJMFF017A05+ ACGACTAACTGTTTNTACCATGTGCTTTTTAGTTTATGAGTTATCCTCACTTTTGTTTTT
rJMFF049C01+ ACGACTAACTGTTTTTACCATGTGCTTTTTAGTTTATGAGTTATCCTCACTTTTGTTTTT
                      ____________________________________________________________
consensus ACGACTAACTGTTTTTACCATGTGCTTTTTAGTTTATGAGTTATCCTCACTTTTGTTTTT
 
. : . : . : . : . : . :
rJMSF015G21+ TTGTTGGTACTGNGACNGTATGTAATAGGGNGTTGAATNTTCTGGNGAACCNACCNAAAC
rJMFF017A05+ TTGTTGGTACTGTGACTGTATGTAATAGGGTGTTGAATNTTNTGGAGAACCAACCAAAAC
rJMFF049C01+ TTGTTGGTACTGTGACTGTATGTAATAGGGTGTTGAATCTTCTGGAGAACCAACCAAAAC
                      ____________________________________________________________
consensus TTGTTGGTACTGTGACTGTATGTAATAGGGTGTTGAATCTTCTGGAGAACCAACCAAAAC
 
. : . : . : . : . : . :
rJMSF015G21+ TGAAAATGACCGGGATTTTTTTTTTTTATTTTTTTTTCAGCTTCTATAGGCATCTAATTC
rJMFF017A05+ TGAAAATGACCGGGA--TTTTTTTTTTATTTTTTTTTCAGCTTCTATAGGCATCTAATTC
rJMFF049C01+ TGAAAATGACCGGGA-TTTTTTTTTTTATTTTTTTTTCAGCTTCTATAGGCATCTAATTC
                      ____________________________________________________________
consensus TGAAAATGACCGGGA-TTTTTTTTTTTATTTTTTTTTCAGCTTCTATAGGCATCTAATTC
 
. : . : . : . : . : . :
rJMSF015G21+ CTTAGCTGTGTGCTGAATATTCTCTTTTGCCATCCTT
rJMFF017A05+ CTTAGCTGTGTGCTGAATATTCTCTTTTGCCATCCTT
rJMFF049C01+ CTTAGCTGTGTGCTGAATATTCTCTTTTGCCATCCTTTGTTTTAAGATGAAAATTACTTC
                      ____________________________________________________________
consensus CTTAGCTGTGTGCTGAATATTCTCTTTTGCCATCCTTTGTTTTAAGATGAAAATTACTTC