Previous Contig 010875:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049B16Sequence631010875 (2)gb:AY054240_15630603e-70Arabidopsis thaliana AT5g21070/T10F18_100 mRNA, complete cds.>gb:AY079115_156817598010875 (2)gb:AY087593_15726232e-59Arabidopsis thaliana clone 3689 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049B16- GATACTGTGAGGATTAAATACGAGATTTTGGCATGAGAAATGA
                      ____________________________________________________________
consensus GATACTGTGAGGATTAAATACGAGATTTTGGCATGAGAAATGA
 
. : . : . : . : . : . :
JMFF049B16- TGTCTTTAATTTCTCACGAATTTAAATTTGCAAATTGGTAATCGAAGGATTTGCCTTCCC
                      ____________________________________________________________
consensus TGTCTTTAATTTCTCACGAATTTAAATTTGCAAATTGGTAATCGAAGGATTTGCCTTCCC
 
. : . : . : . : . : . :
JMFF049B16- AAATTGGTGCAATTTCAATTCCACTTCCTCAATCCTCTTTCCCAGCTCTCAATTTAAGGT
                      ____________________________________________________________
consensus AAATTGGTGCAATTTCAATTCCACTTCCTCAATCCTCTTTCCCAGCTCTCAATTTAAGGT
 
. : . : . : . : . : . :
JMFF049B16- ATATAGGGACAGAAATGGAGAGCGGAGGGGGTTTCACCGCCGGAGATCTGTCCACCATCG
                      ____________________________________________________________
consensus ATATAGGGACAGAAATGGAGAGCGGAGGGGGTTTCACCGCCGGAGATCTGTCCACCATCG
 
. : . : . : . : . : . :
JMFF049B16- GCGGCATCGCCACCGTGTCGTTGCTGCATTCCTTCATTCCTACCCACTGGCTGCCTTTCT
                      ____________________________________________________________
consensus GCGGCATCGCCACCGTGTCGTTGCTGCATTCCTTCATTCCTACCCACTGGCTGCCTTTCT
 
. : . : . : . : . : . :
JMFF049B16- CCATCGTCGGCCGCGCTCAGAAATGGACTCTCTCCCGTACCCTCGTCGTCACTGCACTTG
                      ____________________________________________________________
consensus CCATCGTCGGCCGCGCTCAGAAATGGACTCTCTCCCGTACCCTCGTCGTCACTGCACTTG
 
. : . : . : . : . : . :
JMFF049B16- GGGCAGTTTTGCACGTATTGTCAACTTCACTTCTTGGCATAACTGCAATCACCATATCAA
                      ____________________________________________________________
consensus GGGCAGTTTTGCACGTATTGTCAACTTCACTTCTTGGCATAACTGCAATCACCATATCAA
 
. : . : . : . : . : . :
JMFF049B16- ACACTATTGCTGGGGAGGAAACTGTGCACAAACTTGCTTCTTTGTTGCTCATATTTCTTG
                      ____________________________________________________________
consensus ACACTATTGCTGGGGAGGAAACTGTGCACAAACTTGCTTCTTTGTTGCTCATATTTCTTG
 
. : . : . : . : . : . :
JMFF049B16- GTGGCAGTTATGTCATCTTGTTTCTCACTGGAAAGGGTGGTCATAGCCATTCACACAACC
rJMFF049B16+ GGCAGTTATGTCATCTTGTTTCTCACTGGAAAGGGTGGTCATAGCCATTCACACAACC
                      ____________________________________________________________
consensus GTGGCAGTTATGTCATCTTGTTTCTCACTGGAAAGGGTGGTCATAGCCATTCACACAACC
 
. : . : . : . : . : . :
JMFF049B16- AACCCATGGAAAAAATGGCTGTGGCTGGGCTTGTTCTTGTGCCTGCTTTGTCTCCTTGCG
rJMFF049B16+ AACCCATGGAAAAAATGGCTGTGGCTGGGCTTGTTCTTGTGCCTGCTTTGTCTCCTTGCG
                      ____________________________________________________________
consensus AACCCATGGAAAAAATGGCTGTGGCTGGGCTTGTTCTTGTGCCTGCTTTGTCTCCTTGCG
 
. : . : . : . : . : . :
JMFF049B16- CAACCACTCTGCCTGTATTTCTCGCTGNTGGAAATTCATCTACCATGA
rJMFF049B16+ CAACCACTCTGCCTGTATTTCTCGCTGTTGGAAATTCATCTACCATGATGGTGCTTGCCA
                      ____________________________________________________________
consensus CAACCACTCTGCCTGTATTTCTCGCTGTTGGAAATTCATCTACCATGATGGTGCTTGCCA
 
. : . : . : . : . : . :
rJMFF049B16+ TAATAGTTCTTCTATTCAGCACCATAACGGTAATGACCTCGCTGGTGGCACTCTCATTTT
                      ____________________________________________________________
consensus TAATAGTTCTTCTATTCAGCACCATAACGGTAATGACCTCGCTGGTGGCACTCTCATTTT
 
. : . : . : . : . : . :
rJMFF049B16+ ACGGTGCAAGTCAGCTCAAGTTCCATTGGGTGGAGCGCTATGACAAGCTCCTCGTAGGTT
                      ____________________________________________________________
consensus ACGGTGCAAGTCAGCTCAAGTTCCATTGGGTGGAGCGCTATGACAAGCTCCTCGTAGGTT
 
. : . : . : . : . : . :
rJMFF049B16+ CGGTTCTATGCTTGGTTGGAATCTTAACGCTCATATTCCACGATCACCATCATGATGGAG
                      ____________________________________________________________
consensus CGGTTCTATGCTTGGTTGGAATCTTAACGCTCATATTCCACGATCACCATCATGATGGAG
 
. : . : . : . : . : . :
rJMFF049B16+ AAGCGGGTTCTGCTGGAGACCATCTACACAGAAAAATAATTGCACTGTGAGGTTTAAGTG
                      ____________________________________________________________
consensus AAGCGGGTTCTGCTGGAGACCATCTACACAGAAAAATAATTGCACTGTGAGGTTTAAGTG
 
. : . : . : . : . : . :
rJMFF049B16+ TTATCCTCTTCTTGCTGAGTGTTAAAAATTAGTGTACATTTGAACCTTAACTCCTTAAGT
                      ____________________________________________________________
consensus TTATCCTCTTCTTGCTGAGTGTTAAAAATTAGTGTACATTTGAACCTTAACTCCTTAAGT
 
. : . : . : . : . : . :
rJMFF049B16+ AATGGAAAGTTCAATGTAAAATTTTTGTTCATTGTACTATTAATGAACATCCATATCTAT
                      ____________________________________________________________
consensus AATGGAAAGTTCAATGTAAAATTTTTGTTCATTGTACTATTAATGAACATCCATATCTAT
 
. : . : . : . : . : . :
rJMFF049B16+ TCAACTATGTTGGGTTAGCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TCAACTATGTTGGGTTAGCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG