Previous Contig 010873:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049B10Sequence637010873 (6)gb:AY050973_15624534e-57Arabidopsis thaliana unknown protein (At3g17365) mRNA, complete cds.>gb:AY122997644010873 (6)gb:AY050973_15624533e-26Arabidopsis thaliana unknown protein (At3g17365) mRNA, complete cds.>gb:AY122997
JMSF013J20Sequence396010873 (6)gb:AP004708_18437787e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070685010873 (6)gb:AY050973_15624539e-09Arabidopsis thaliana unknown protein (At3g17365) mRNA, complete cds.>gb:AY122997
JMSF015H18Sequence466010873 (6)gb:AP004708_18437784e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070768010873 (6)gb:AY050973_15624531e-08Arabidopsis thaliana unknown protein (At3g17365) mRNA, complete cds.>gb:AY122997

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013J20- GAG
JMSF015H18- GAG
                      ____________________________________________________________
consensus GAG
 
. : . : . : . : . : . :
JMSF013J20- TGTCTAGTCTGGTAATAAACAGAACAGAAGAGATCGCCATTGTTGAGTGAGAGAGAGAGA
JMSF015H18- TGTCTAGTCTGGTAATAAACAGAACAGAAGAGATCGCCATTGTTGAGTGAGAGAGAGAGA
JMFF049B10- GTTGTGTGAGAGAGAGAGA
                      ____________________________________________________________
consensus TGTCTAGTCTGGTAATAAACAGAACAGAAGAGATCGCCATTGTTGAGTGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF013J20- GCTCCATACTTAAGAGTTACTGGAGTGTTACAGAGAGAGAGAGAGAGAGAGAGAGAATTG
JMSF015H18- GCTCCATACTTAAGAGTTACTGGAGTGTTAC--AGAGAGAGAGAGAGAGAGAGAGAATTG
JMFF049B10- GCTCCATACTTAAGAGTTACTGGAGTGTTAC--AGAGAGAGAGAGAGAGAGAGAGAATTG
                      ____________________________________________________________
consensus GCTCCATACTTAAGAGTTACTGGAGTGTTAC--AGAGAGAGAGAGAGAGAGAGAGAATTG
 
. : . : . : . : . : . :
JMSF013J20- AGAAGGAGAAATGACACTAGGGGGAGGTGGAACAACGCANGTGGCGTACGGAGACAAATG
JMSF015H18- AGAAGGAGAAATGACACTAGGGGGAGGTGGAACAACGCAGGTGGCGTACGGAGACAAATG
JMFF049B10- AGAAGGAGAAATGACACTAGGGGGAGGTGGAACAACGCAGGTGGCGTACGGAGACAAATG
                      ____________________________________________________________
consensus AGAAGGAGAAATGACACTAGGGGGAGGTGGAACAACGCAGGTGGCGTACGGAGACAAATG
 
. : . : . : . : . : . :
JMSF013J20- GTATTGGGAGAAGCGATACGCACAAGAACCGGTTCCCTACGATTGGTACCAAACCTATCA
JMSF015H18- GTATTGGGAGAAGCGATACGCACAAGAACCGGTTCCCTACGATTGGTACCAAACCTATCA
JMFF049B10- GTATTGGGAGAAGCGATACGCACAAGAACCGGTTCCCTACGATTGGTACCAAACCTATCA
                      ____________________________________________________________
consensus GTATTGGGAGAAGCGATACGCACAAGAACCGGTTCCCTACGATTGGTACCAAACCTATCA
 
. : . : . : . : . : . :
JMSF013J20- CTCCCTCGCCCCCCTCCTCCGCCTCTACGTTCATCCCCACCACCGCGTCCTCGTCGTCGG
JMSF015H18- CTCCCTCGCCCCCCTCCTCCGCCTCTACGTTCATCCCCACCACCGCGTCCTCGTCGTCGG
JMFF049B10- CTCCCTCGCCCCCCTCCTCCGCCTCTACGTTCATCCCCACCACCGCGTCCTCGTCGTCGG
                      ____________________________________________________________
consensus CTCCCTCGCCCCCCTCCTCCGCCTCTACGTTCATCCCCACCACCGCGTCCTCGTCGTCGG
 
. : . : . : . : . : . :
JMSF013J20- TTGCGGCAATTCCGCTTTTAGTGAGGGCATGATTGATGACGGTTATGCGGATGTANTCAA
JMSF015H18- TTGCGGCAATTCCGCTTTTAGTGAGGGCATGATTGATGACGGTTATGCGGATGTANTCAA
JMFF049B10- TTGCGGCAATTCCGCTTTTAGTGAGGGCATGATTGATGACGGTTATGCGGATGTAGTCAA
                      ____________________________________________________________
consensus TTGCGGCAATTCCGCTTTTAGTGAGGGCATGATTGATGACGGTTATGCGGATGTAGTCAA
 
. : . : . : . : . : . :
JMSF013J20- TGTTGATAGTTCCTCCGTGGTAATTGAAGCA
JMSF015H18- TGTTGATAGTTCCTCCGTGGTAATTGAAGCAATGCGGAAGAAATATTCCAATCGTCCACA
JMFF049B10- TGTTGATAGTTCCTCCGTGGTAATTGAAGCAATGCGGAAGAAATATTCCAATCGTCCACA
                      ____________________________________________________________
consensus TGTTGATAGTTCCTCCGTGGTAATTGAAGCAATGCGGAAGAAATATTCCAATCGTCCACA
 
. : . : . : . : . : . :
JMSF015H18- ACTGAAAT
JMFF049B10- ACTGAAATATATGAACATGGATGTTAGAGACATGAGTGCCTTTGAAGCCGGTTCCTTTGA
                      ____________________________________________________________
consensus ACTGAAATATATGAACATGGATGTTAGAGACATGAGTGCCTTTGAAGCCGGTTCCTTTGA
 
. : . : . : . : . : . :
JMFF049B10- TGCCATTATTGATAAAGGAACTTTGGACTCCATCTTGTGTGGGAACGGTTCGACGATAAA
                      ____________________________________________________________
consensus TGCCATTATTGATAAAGGAACTTTGGACTCCATCTTGTGTGGGAACGGTTCGACGATAAA
 
. : . : . : . : . : . :
JMFF049B10- TGCTGCTCAGATGCTTGCTGAAGTCTGCAGGGTCCTGAAGGATGAAGGAAAATATGTCCT
                      ____________________________________________________________
consensus TGCTGCTCAGATGCTTGCTGAAGTCTGCAGGGTCCTGAAGGATGAAGGAAAATATGTCCT
 
. : . : . : . : . : . :
JMFF049B10- GATTACTTATGGAGCTCCAGTTCAGCGACTACCTTTGTTGAGAAACTCATGCTCATTGAC
rJMSF015H18+ GATTACTTATGGAGCTCCAGTTCAGCGACTACCTTTGTTGAGAAACTCATGCTCATTGAC
                      ____________________________________________________________
consensus GATTACTTATGGAGCTCCAGTTCAGCGACTACCTTTGTTGAGAAACTCATGCTCATTGAC
 
. : . : . : . : . : . :
JMFF049B10- NATTAAATTACATGTCAT
rJMSF013J20+ AAATTACATGTCATAGGTATTTTCAATCGTCCTATTNGTCTTCGTTGTCTTTTCTT
rJMSF015H18+ AATTAAATTACATGTCATAGGTATTTTCAATCGTCCTATTTGTCTTCGTTGTCTTTTCTT
                      ____________________________________________________________
consensus AATTAAATTACATGTCATAGGTATTTTCAATCGTCCTATTTGTCTTCGTTGTCTTTTCTT
 
. : . : . : . : . : . :
rJMSF013J20+ GAACTGAAAATTATTTTTCGACTCGACTCCCCTCGCCCAACTAAGTGAACAACAACAATC
rJMSF015H18+ GAACTGAAAATTATTTTTCGACTCGACTCCCCTCGCCCAACTAAGTGAACAACAACAATC
                      ____________________________________________________________
consensus GAACTGAAAATTATTTTTCGACTCGACTCCCCTCGCCCAACTAAGTGAACAACAACAATC
 
. : . : . : . : . : . :
rJMSF013J20+ TGTTTGAATATGATTAATAGATATCTTAGTCACGAAACTGTGAAGTACTAGATGTTTTGT
rJMSF015H18+ TGTTTGAATATGATTAATAGATATCTTAGTCACGAAACTGTGAAGTACTAGATGTTTTGT
                      ____________________________________________________________
consensus TGTTTGAATATGATTAATAGATATCTTAGTCACGAAACTGTGAAGTACTAGATGTTTTGT
 
. : . : . : . : . : . :
rJMSF013J20+ TGTTCTTCATGTTCTGTTAACATAGGCTGCTCGCAAAGATTCCCTCGTAACTGCAGTTTG
rJMSF015H18+ TGTTCTTCATGTTCTGTTAACATAGGCTGCTCGCAAAGATTCCCTCGTAACTGCAGTTTG
                      ____________________________________________________________
consensus TGTTCTTCATGTTCTGTTAACATAGGCTGCTCGCAAAGATTCCCTCGTAACTGCAGTTTG
 
. : . : . : . : . : . :
rJMSF013J20+ ATAATTGACTTTATCCTTGTGTCTTGCTCGTATCGGTGCAGACAAAGTTCCTACAGGGAG
rJMSF015H18+ ATAATTGACTTTATCCTTGTGTCTTGCTCGTATCGGTGCAGACAAAGTTCCTACAGGGAG
rJMFF049B10+ AGACAAAGTTCCTACAGGGAG
                      ____________________________________________________________
consensus ATAATTGACTTTATCCTTGTGTCTTGCTCGTATCGGTGCAGACAAAGTTCCTACAGGGAG
 
. : . : . : . : . : . :
rJMSF013J20+ CTCGCACCAGCAAAAATGGGAACTGACTTCACCCATTGCATTGGATAAAGATGTGAGCTC
rJMSF015H18+ CTCGCACCAGCAAAAATGGGAACTGACTTCACCCATTGCATTGGATAAAGATGTGAGCTC
rJMFF049B10+ CTCGCACCAGCAAAAATGGGAACTGACTTCACCCATTGCATTGGATAAAGATGTGAGCTC
                      ____________________________________________________________
consensus CTCGCACCAGCAAAAATGGGAACTGACTTCACCCATTGCATTGGATAAAGATGTGAGCTC
 
. : . : . : . : . : . :
rJMSF013J20+ CGTGGAATCGGTTTTGGGGCCGAATCCAAGCGTTCACTATATATACGTTTGTGTTAAGGA
rJMSF015H18+ CGTGGAATCGGTTTTGGGGCCGAATCCAAGCGTTCACTATATATACGTTTGTGTTAAGGA
rJMFF049B10+ CGTGGAATCGGTTTTGGGGCCGAATCCAAGCGTTCACTATATATACGTTTGTGTTAAGGA
                      ____________________________________________________________
consensus CGTGGAATCGGTTTTGGGGCCGAATCCAAGCGTTCACTATATATACGTTTGTGTTAAGGA
 
. : . : . : . : . : . :
rJMSF013J20+ TAATACTTTGGAGTCCAGGCACAAAGCACAGATCAAGAATTGAAGGATGAAGCTGGTCTC
rJMSF015H18+ TAATACTTTGGAGTCCAGGCACAAAGCACAGATCAAGAATTGAAGGATGAAGCTGGTCTC
rJMFF049B10+ TAATACTTTGGAGTCCAGGCACAAAGCACAGATCAAGAATTGAAGGATGAAGCTGGTCTC
                      ____________________________________________________________
consensus TAATACTTTGGAGTCCAGGCACAAAGCACAGATCAAGAATTGAAGGATGAAGCTGGTCTC
 
. : . : . : . : . : . :
rJMSF013J20+ CTTTTGCCCTTAAGTGGAAGGCCAATCACTCACTATATATACTGATACGGATTCCTTTGT
rJMSF015H18+ CTTTTGCCCTTAAGTGGAAGGCCAATCACTCACTATATATACTGATACGGATTCCTTTGT
rJMFF049B10+ CTTTTGCCCTTAAGTGGAAGGCCAATCACTCACTATATATACTGATACGGATTCCTTTGT
                      ____________________________________________________________
consensus CTTTTGCCCTTAAGTGGAAGGCCAATCACTCACTATATATACTGATACGGATTCCTTTGT
 
. : . : . : . : . : . :
rJMSF013J20+ TGCCCTCCTGCCCGGCATGAATCCCTTTTTTTTGTATCTATATCCCGCAAGATGATATTA
rJMSF015H18+ TGCCCTCCTGCCCGGCATGAATCCCTTTTTTTTGTATCTATATCCCGCAAGATGATATTA
rJMFF049B10+ TGCCCTCCTGCCCGGCATGAATCCCTTTTTTTTGTATCTATATCCCGCAAGATGATATTA
                      ____________________________________________________________
consensus TGCCCTCCTGCCCGGCATGAATCCCTTTTTTTTGTATCTATATCCCGCAAGATGATATTA
 
. : . : . : . : . : . :
rJMSF013J20+ ATATCAGTCGAACCTAAACAGCTCGATCCGATTTGTAATAATGTTCTATGGTGAGAGGCA
rJMSF015H18+ ATA-CAGTCGAACCTAAACAGCTCGATCCGATTTGTAATAATGTTCTATGGTGAGAGGCA
rJMFF049B10+ ATA-CAGTCGAACCTAAACAGCTCGATCCGATTTGTAATAATGTTCTATGGTGAGAGGCA
                      ____________________________________________________________
consensus ATA-CAGTCGAACCTAAACAGCTCGATCCGATTTGTAATAATGTTCTATGGTGAGAGGCA
 
. : . : . : . : . : . :
rJMSF013J20+ TGCTGGGTAAACTTTG
rJMSF015H18+ TGCTGGGTAAACTTTGCTGTTTT
rJMFF049B10+ TGCTGGGTAAACTTTGCTGTTTTTGTCTGATGATAAAATGAATGAAATGAGGTTTCAGGA
                      ____________________________________________________________
consensus TGCTGGGTAAACTTTGCTGTTTTTGTCTGATGATAAAATGAATGAAATGAGGTTTCAGGA
 
. : . : . : . : . : . :
rJMFF049B10+ GACTCACAATTTGACTTTGCAAAAAAAAAAAAAAAACTTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GACTCACAATTTGACTTTGCAAAAAAAAAAAAAAAACTTCCAGGGTGATCCGCCATAAGG