Previous Contig 010871:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N24Sequence548006614 (3)794010871 (3)gb:BC019429_20929115e-65Mus musculus cDNA clone MGC:30371 IMAGE:5149920, complete cds.
JMFF049B01Sequence647006614 (3)635010871 (3)gb:AY024357_15590103e-18Arabidopsis thaliana floral homeotic protein HUA1 (HUA1) mRNA, complete cds.
JMSF029L18Sequence688006614 (3)745010871 (3)gb:BC019429_20929114e-54Mus musculus cDNA clone MGC:30371 IMAGE:5149920, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014N24+ TGCTGC
                      ____________________________________________________________
consensus TGCTGC
 
. : . : . : . : . : . :
rJMFF014N24+ ATAATTCCAAGGGTCTCCCTATCAGACTGGGTGAAGTTGATTGCCCTTTCTACTTAAAAA
                      ____________________________________________________________
consensus ATAATTCCAAGGGTCTCCCTATCAGACTGGGTGAAGTTGATTGCCCTTTCTACTTAAAAA
 
. : . : . : . : . : . :
rJMFF014N24+ CTGGAAGCTGTAAGTATGGAGCCACTTGCCGCTACAATCATCCAGACAGATATACAATCA
                      ____________________________________________________________
consensus CTGGAAGCTGTAAGTATGGAGCCACTTGCCGCTACAATCATCCAGACAGATATACAATCA
 
. : . : . : . : . : . :
rJMFF014N24+ ATCCACCTGCAGCACATCTTAATGTTGGGGTTGTTAATCCAACTGCCTCACTTTTTCAAA
rJMSF029L18+ CCTGCAGCACATCTTAATGTTGGGGTTGTTAATCCAACTGCCTCACTTTTTCAAA
                      ____________________________________________________________
consensus ATCCACCTGCAGCACATCTTAATGTTGGGGTTGTTAATCCAACTGCCTCACTTTTTCAAA
 
. : . : . : . : . : . :
rJMFF014N24+ CATTTGACCCTAGATTGACTCAAACAATGTTTGGATTTGCCACAACTATCTACCCACAAC
rJMSF029L18+ CATTTGACCCTAGATTGACTCAAACAATGTTTGGATTTGCCACAACTATCTACCCACAAC
                      ____________________________________________________________
consensus CATTTGACCCTAGATTGACTCAAACAATGTTTGGATTTGCCACAACTATCTACCCACAAC
 
. : . : . : . : . : . :
rJMFF014N24+ GGCCTGGACAGGTTGAATGTGATTTCTACATGAAAACTGGGGAGTGCAAATTTGGAGAGA
rJMSF029L18+ GGCCTGGACAGGTTGAATGTGATTTCTACATGAAAACTGGGGAGTGCAAATTTGGAGAGA
                      ____________________________________________________________
consensus GGCCTGGACAGGTTGAATGTGATTTCTACATGAAAACTGGGGAGTGCAAATTTGGAGAGA
 
. : . : . : . : . : . :
rJMFF014N24+ GATGCAGGTTTCACCACCCTCTTGATCATTCATTATCTGTTACATCCTCAATGGAAGGCG
rJMSF029L18+ GATGCAGGTTTCACCACCCTCTTGATCATTCATTATCTGTTACATCCTCAATGGAAGGCG
rJMFF049B01+ GTTACATCCTCAATGGAAGGCG
                      ____________________________________________________________
consensus GATGCAGGTTTCACCACCCTCTTGATCATTCATTATCTGTTACATCCTCAATGGAAGGCG
 
. : . : . : . : . : . :
rJMFF014N24+ AGCAGCAAAATTTTAAGCTCAGTCTTGCAGGGCTACCTAGACGTGAGGGTGCTATACATT
rJMSF029L18+ AGCAGCAAAATTTTAAGCTCAGTCTTGCAGGGCTACCTAGACGTGAGGGTGCTATACATT
rJMFF049B01+ AGCAGCAAAATTTTAAGCTCAGTCTTGCAGGGCTACCTAGACGTGAGGGTGCTATACATT
                      ____________________________________________________________
consensus AGCAGCAAAATTTTAAGCTCAGTCTTGCAGGGCTACCTAGACGTGAGGGTGCTATACATT
 
. : . : . : . : . : . :
rJMFF014N24+ GTCCGTATTATATGAAAACTGGAATATGCAAGTTTGGAGCAACTTGCAAATTTGATCATC
rJMSF029L18+ GTCCGTATTATATGAAAACTGGAATATGCAAGTTTGGAGCAACTTGCAAATTTGATCATC
rJMFF049B01+ GTCCGTATTATATGAAAACTGGAATATGCAAGTTTGGAGCAACTTGCAAATTTGATCATC
                      ____________________________________________________________
consensus GTCCGTATTATATGAAAACTGGAATATGCAAGTTTGGAGCAACTTGCAAATTTGATCATC
 
. : . : . : . : . : . :
rJMFF014N24+ CGCCACCAGGGGAGTTAATAGGTGGTACTTCACAGGTAACTTCTACATCTGTTGGTGAAG
rJMSF029L18+ CGCCACCAGGGGAGTTAATAGGTGGTACTTCACAGGTAACTTCTACATCTGTTGGTGAAG
rJMFF049B01+ CGCCACCAGGGGAGTTAATAGGTGGTACTTCACAGGTAACTTCTACATCTGTTGGTGAAG
                      ____________________________________________________________
consensus CGCCACCAGGGGAGTTAATAGGTGGTACTTCACAGGTAACTTCTACATCTGTTGGTGAAG
 
. : . : . : . : . : . :
rJMFF014N24+ AGGAAGGATATGCGAAATTGGTTGAAGCCATTCAGAAACAGCAGCAATAAACATTTTGTT
rJMSF029L18+ AGGAAGGATATGCGAAATTGGTTGAAGCCATTCAGAAACAGCAGCAATAAACATTTTGTT
rJMFF049B01+ AGGAAGGATATGCGAAATTGGTTGAAGCCATTCAGAAACAGCAGCAATAAACATTTTGTT
                      ____________________________________________________________
consensus AGGAAGGATATGCGAAATTGGTTGAAGCCATTCAGAAACAGCAGCAATAAACATTTTGTT
 
. : . : . : . : . : . :
rJMFF014N24+ CTGTTCAGCAGAGGATTTGATCCGCTACCTCTTCTAGCCCTGACTACACTCTGAGGGAAC
rJMSF029L18+ CTGTTCAGCAGAGGATTTGATCCGCTACCTCTTCTAGCCCTGACTACACTCTGAGGGAAC
rJMFF049B01+ CTGTTCAGCAGAGGATTTGATCCGCTACCTCTTCTAGCCCTGACTACACTCTGAGGGAAC
                      ____________________________________________________________
consensus CTGTTCAGCAGAGGATTTGATCCGCTACCTCTTCTAGCCCTGACTACACTCTGAGGGAAC
 
. : . : . : . : . : . :
rJMFF014N24+ TAATAATTGTTTCAGATTTGGTTGATGAGTTATTATATTTTATTTTCAAATTCTGAAGTT
rJMSF029L18+ TAATAATTGTTTCAGATTTGGTTGATGAGTTATTATATTTTATTTTCAAATTCTGAAGTT
rJMFF049B01+ TAATAATTGTTTCAGATTTGGTTGATGAGTTATTATATTTTATTTTCAAATTCTGAAGTT
                      ____________________________________________________________
consensus TAATAATTGTTTCAGATTTGGTTGATGAGTTATTATATTTTATTTTCAAATTCTGAAGTT
 
. : . : . : . : . : . :
rJMFF014N24+ GGATTGCCTATGTTGTATTCCTTGTAACTGGCGGAGAATAGTAGCTAGC-TTGAAATGCG
rJMSF029L18+ GGATTGCCTATGTTGTATTCCTTGTAACTGGCGGAGAATAGTAGCTAGCTTTGAAATGCG
rJMFF049B01+ GGATTGCCTATGTTGTATTCCTTGTAACTGGCGGAGAATAGTAGCTAGCTTTGAAATGCG
                      ____________________________________________________________
consensus GGATTGCCTATGTTGTATTCCTTGTAACTGGCGGAGAATAGTAGCTAGCTTTGAAATGCG
 
. : . : . : . : . : . :
rJMFF014N24+ TTTATATAG
rJMSF029L18+ TTTATATAGTTGGTGTT
rJMFF049B01+ TTTATATAGTTGGTGTTATGTCTTTTCTAGTGGACGGAGCTCTATAATGATTTGCTACTC
                      ____________________________________________________________
consensus TTTATATAGTTGGTGTTATGTCTTTTCTAGTGGACGGAGCTCTATAATGATTTGCTACTC
 
. : . : . : . : . : . :
rJMFF049B01+ TTCACTGTGTTTTGACGTTGGTGTGCAGGATGATGACGATTGTGCTATTTTTTTATTTGG
                      ____________________________________________________________
consensus TTCACTGTGTTTTGACGTTGGTGTGCAGGATGATGACGATTGTGCTATTTTTTTATTTGG
 
. : . : . : . : . : . :
rJMFF049B01+ GAAAATGGTAAAATAATCAAATGATTAAATGGGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GAAAATGGTAAAATAATCAAATGATTAAATGGGAAAAAAAAAAAAAAAACTCTCCAGGGT