Previous Contig 010867:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012C03Sequence466002100 (2)gb:AC105318_17379130.002Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1058_F05, complete s749010867 (4)gb:AF245484_17804685e-25Oryza sativa OSE2 (OSE2) gene, complete cds.
JMFF021O12Sequence660010867 (4)gb:AF245484_17804684e-25Oryza sativa OSE2 (OSE2) gene, complete cds.
JMFF049A09Sequence441002100 (2)425010867 (4)gb:AY086457_15715050.004Arabidopsis thaliana clone 25211 mRNA, complete sequence.
JMSF021M05Sequence610007094 (2)gb:AY085371_15704423e-21Arabidopsis thaliana clone 148254 mRNA, complete sequence.342010867 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012C03+ CTGGATTTAAAGTGGATGCCATGGTGAATGCGGCGAATTGTCAGTTTCCAGTC
                      ____________________________________________________________
consensus CTGGATTTAAAGTGGATGCCATGGTGAATGCGGCGAATTGTCAGTTTCCAGTC
 
. : . : . : . : . : . :
rJMFF012C03+ GCCATGCAGACTGGACCGGGTGGATTTGGTGTGGAGCCGCCTCACATGGGGTTCGGGAAT
rJMFF021O12+ CCTCACATGGGGTTCGGGAAT
                      ____________________________________________________________
consensus GCCATGCAGACTGGACCGGGTGGATTTGGTGTGGAGCCGCCTCACATGGGGTTCGGGAAT
 
. : . : . : . : . : . :
rJMFF012C03+ GGCGTGGTGGCTATAGGATGTAACAGCGGCAGCAGCGGTGGCGGCAGAGGGAAGAGGAGG
rJMFF021O12+ GGCGTGGTGGCTATAGGATGTAACAGCGGCAGCAGCGGTGGCGGCAGAGGGAAGAGGAGG
                      ____________________________________________________________
consensus GGCGTGGTGGCTATAGGATGTAACAGCGGCAGCAGCGGTGGCGGCAGAGGGAAGAGGAGG
 
. : . : . : . : . : . :
rJMFF012C03+ GCAACCGTGGAGGAGATGCCCCTCGATAAGGCCACGCAGCAGAAGCAGAGGCGAATGATC
rJMFF021O12+ GCAACCGTGGAGGAGATGCCCCTCGATAAGGCCACGCAGCAGAAGCAGAGGCGAATGATC
                      ____________________________________________________________
consensus GCAACCGTGGAGGAGATGCCCCTCGATAAGGCCACGCAGCAGAAGCAGAGGCGAATGATC
 
. : . : . : . : . : . :
rJMFF012C03+ AAGAACAGAGAGTCTGCGGCTAGGTCCAGGGAACGAAAACAGGCTTACACTGTGGAGCTG
rJMFF021O12+ AAGAACAGAGAGTCTGCGGCTAGGTCCAGGGAACGAAAACAGGCTTACACTGTGGAGCTG
                      ____________________________________________________________
consensus AAGAACAGAGAGTCTGCGGCTAGGTCCAGGGAACGAAAACAGGCTTACACTGTGGAGCTG
 
. : . : . : . : . : . :
rJMSF021M05+ TGAGNGAAGAGGCGGNG
rJMFF012C03+ GAGTCTCTGGTAACACAATTGGAGGAGGATAATGCTAGGCTTCTGAGAGAAGAGGCGGAG
rJMFF021O12+ GAGTCTCTGGTAACACAATTGGAGGAGGATAATGCTAGGCTTCTGAGAGAAGAGGCGGAG
                      ____________________________________________________________
consensus GAGTCTCTGGTAACACAATTGGAGGAGGATAATGCTAGGCTTCTGAGAGAAGAGGCGGAG
 
. : . : . : . : . : . :
rJMSF021M05+ CNGAATAAGAAGAGACNTAAGCAGCTCATGGAGAATCTGATTCCTGTCGTGGAGAAGAGG
rJMFF012C03+ CAGAATAAGAAGAGACTTAAGCAGCTCATGGAGAATCTGATTCCTGTCGTGGAGAAGAGG
rJMFF021O12+ CAGAATAAGAAGAGACTTAAGCAGCTCATGGAGAATCTGATTCCTGTCGTGGAGAAGAGG
rJMFF049A09+ GAATAAGAAGAGACTTAAGCAGCTCATGGAGAATCTGATTCCTGTCGTGGAGAAGAGG
                      ____________________________________________________________
consensus CAGAATAAGAAGAGACTTAAGCAGCTCATGGAGAATCTGATTCCTGTCGTGGAGAAGAGG
 
. : . : . : . : . : . :
rJMSF021M05+ AGGCCACCAAGAGTTCTGCGCAGAATCCATTCCATGNCCNGGTAAGTTGTATCATCNTAT
rJMFF012C03+ AGGCCACCAAGAGTTCTGCGCAGAATCCATTCCATGACCTGGTAAGTTGTATCATCATAT
rJMFF021O12+ AGGCCACCAAGAGTTCTGCGCAGAATCCATTCCATGACCTGGTAAGTTGTATCATCATAT
rJMFF049A09+ AGGCCACCAAGAGTTCTGCGCAGAATCCATTCCATGACCTGGTAAGTTGTATCATCATAT
                      ____________________________________________________________
consensus AGGCCACCAAGAGTTCTGCGCAGAATCCATTCCATGACCTGGTAAGTTGTATCATCATAT
 
. : . : . : . : . : . :
rJMSF021M05+ CATAAACAGTAACAGCGGGTGACNGGTTAACCAAGAAGCAATATCGGNTATGGCAAAATC
rJMFF012C03+ CATAAACAGTAACAGCGGGTGACTGGTTAACCAAGAAGCAATATCGGCTATGGCAAAATC
rJMFF021O12+ CATAAACAGTAACAGCGGGTGACTGGTTAACCAAGAAGCAATATCGGCTATGGCAAAATC
rJMFF049A09+ CATAAACAGTAACAGCGGGTGACTGGTTAACCAAGAAGCAATATCGGCTATGGCAAAATC
                      ____________________________________________________________
consensus CATAAACAGTAACAGCGGGTGACTGGTTAACCAAGAAGCAATATCGGCTATGGCAAAATC
 
. : . : . : . : . : . :
rJMSF021M05+ TGGGGGCGACATATATGGTTGGAGCTGTAATGGATGTTTNAGACTTGAACATGAGTAGGG
rJMFF012C03+ TGGGGGCGACATATATGGTTGGAGCTGTAATGGATGTTTTAGACTTGAACATGAGTAGGG
rJMFF021O12+ TGGGGGCGACATATATGGTTGGAGCTGTAATGGATGTTTTAGACTTGAACATGAGTAGGG
rJMFF049A09+ TGGGGGCGACATATATGGTTGGAGCTGTAATGGATGTTTTAGACTTGAACATGAGTAGGG
                      ____________________________________________________________
consensus TGGGGGCGACATATATGGTTGGAGCTGTAATGGATGTTTTAGACTTGAACATGAGTAGGG
 
. : . : . : . : . : . :
rJMSF021M05+ CTATNAACAATGTGAATCAAATGTGTAATTNTGGGTN-TGCATAAGTTANCNGCAGGTNT
rJMFF012C03+ CTATAAACAATGTGAATCAAATGTGTAATTGTGGGTC-TGCATAAGTTAGCTGCAGGTGT
rJMFF021O12+ CTATAAACAATGTGAATCAAATGTGTAATTGTGGGTC-TGCATAAGTTAGCTGCAGGTGT
rJMFF049A09+ CTATAAACAATGTGAATCAAATGTGTAATTGTGGGTCTTGCATAAGTTAGCTGCAGGTGT
                      ____________________________________________________________
consensus CTATAAACAATGTGAATCAAATGTGTAATTGTGGGTC-TGCATAAGTTAGCTGCAGGTGT
 
. : . : . : . : . : . :
rJMSF021M05+ AATAGAATAGGGCCATAAGTTTCTGC
rJMFF012C03+ AATAGAATAGGGCCATAAGTTTCTGCTTATATTAACTATTGTAGCTTCCGCACCATTGGT
rJMFF021O12+ AATAGAATAGGGCCATAAGTTTCTGCTTATATTAACTATTGTAGCTTCCGCACCATTGGT
rJMFF049A09+ AATAGAATAGGGCCATAAGTTTCTGCTTATATTAACTATTGTAGCTTCCGCACCATTGGT
                      ____________________________________________________________
consensus AATAGAATAGGGCCATAAGTTTCTGCTTATATTAACTATTGTAGCTTCCGCACCATTGGT
 
. : . : . : . : . : . :
rJMFF012C03+ GGCAGGGAAGAATGGTGAACTTGGCTGGTTTATACAT
rJMFF021O12+ GGCAGGGAAGAATGGTGAACTTGGCTGGTTTATACAT
rJMFF049A09+ GGCAGGGAAGAATGGTGAACTTGGCTGGTTTATACATTTAATGAATATGTATTTTAGAGT
                      ____________________________________________________________
consensus GGCAGGGAAGAATGGTGAACTTGGCTGGTTTATACATTTAATGAATATGTATTTTAGAGT