Previous Contig 010862:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017H13Sequence564000898 (5)pir|E96786|E967868e-22protein F10A5.13 [imported] - Arabidopsis thaliana>gb:AE005173_895104 Arabidopsi714010862 (6)pir|G86332|G863324e-71F6F9.1 protein - Arabidopsis thaliana>gb:AE005172_890955 Arabidopsis thaliana ch
JMFF036F14Sequence557000898 (5)pir|E96786|E967862e-21protein F10A5.13 [imported] - Arabidopsis thaliana>gb:AE005173_895104 Arabidopsi713010862 (6)pir|G86332|G863322e-71F6F9.1 protein - Arabidopsis thaliana>gb:AE005172_890955 Arabidopsis thaliana ch
JMFF048P15Sequence405015098313010862 (6)
JMFF049P02Sequence591000898 (5)pir|E96786|E967864e-27protein F10A5.13 [imported] - Arabidopsis thaliana>gb:AE005173_895104 Arabidopsi597010862 (6)pir|G86332|G863326e-50F6F9.1 protein - Arabidopsis thaliana>gb:AE005172_890955 Arabidopsis thaliana ch
JMSF041E18Sequence819000898 (5)gb:AP005092_18476644e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11735010862 (6)pir|G86332|G863322e-76F6F9.1 protein - Arabidopsis thaliana>gb:AE005172_890955 Arabidopsis thaliana ch
JMSF041G05Sequence814000898 (5)pir|E96786|E967863e-64protein F10A5.13 [imported] - Arabidopsis thaliana>gb:AE005173_895104 Arabidopsi687010862 (6)pir|G86332|G863322e-65F6F9.1 protein - Arabidopsis thaliana>gb:AE005172_890955 Arabidopsis thaliana ch

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041E18+ TTGAAGTATAGGAGCACT
                      ____________________________________________________________
consensus TTGAAGTATAGGAGCACT
 
. : . : . : . : . : . :
rJMSF041E18+ GCAGAANGCAGTTATGTGTGGGCTCTTACCGAAATCTCCTACAGCCACTTCCAGCAGAAC
rJMSF041G05+ TACAGCCACTTTCAGCAGAAC
rJMFF036F14+ TACAGCCACTTCCAGCAGAAC
rJMFF017H13+ TACAGCCACTTCCAGCAGAAC
                      ____________________________________________________________
consensus GCAGAANGCAGTTATGTGTGGGCTCTTACCGAAATCTCCTACAGCCACTTCCAGCAGAAC
 
. : . : . : . : . : . :
rJMSF041E18+ CGATTCGGG-TTTAGTATGGATAAGCCAATGGAACGCTTTGCAGCATCCGGTAGCCTCGG
rJMSF041G05+ CGATTCGGGTTTTAGTATGGATAAGCCAATGGAACGCTTTGCAGCATCCGGTAGCCTCGG
rJMFF036F14+ CGATTCGGG-TTTAGTATGGATAAGCCAATGGAACGCTTTGCAGCATCCGGTAGCCTCGG
rJMFF017H13+ CGATTCGGG-TTTAGTATGGATAAGCCAATGGAACGCTTTGCAGCATCCGGTAGCCTCGG
                      ____________________________________________________________
consensus CGATTCGGG-TTTAGTATGGATAAGCCAATGGAACGCTTTGCAGCATCCGGTAGCCTCGG
 
. : . : . : . : . : . :
rJMSF041E18+ CNTTCTTAGCTGTAGTCTACAGCGATTACATGCTTTCGTCTCGCACTGCAAAGATAACGT
rJMSF041G05+ CCTTCTTAGCTGTAGTCTACAGCGATTACATGCTTTCGTCTCGCACTGCAAAGATAACGT
rJMFF036F14+ CCTTCTTAGCTGTAGTCTACAGCGATTACATGCTTTCGTCTCGCACTGCAAAGATAACGT
rJMFF017H13+ CCTTCTTAGCTGTAGTCTACAGCGATTACATGCTTTCGTCTCGCACTGCAAAGATAACGT
rJMFF049P02+ CTGCAAAGATAACGT
                      ____________________________________________________________
consensus CCTTCTTAGCTGTAGTCTACAGCGATTACATGCTTTCGTCTCGCACTGCAAAGATAACGT
 
. : . : . : . : . : . :
rJMSF041E18+ GCGATGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
rJMSF041G05+ GCGATGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
rJMFF036F14+ GCGATGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
rJMFF017H13+ GCGCTGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
rJMFF049P02+ GCGATGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
                      ____________________________________________________________
consensus GCGATGGGAAATATTATACCCCGTCTGATCTGCGGAAGTTTGCCATGTCACAGGCTGATT
 
. : . : . : . : . : . :
rJMSF041E18+ ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
rJMSF041G05+ ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
rJMFF036F14+ ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
rJMFF017H13+ ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
rJMFF049P02+ ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
                      ____________________________________________________________
consensus ATGTTTTGGGTGACAATCCAATGAAGATGAGTTATCTCGTTGGGTATGGGGACAACTACC
 
. : . : . : . : . : . :
rJMSF041E18+ CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
rJMSF041G05+ CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
rJMFF036F14+ CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
rJMFF017H13+ CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
rJMFF049P02+ CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
                      ____________________________________________________________
consensus CGAAATACGTTCACCATCGAGGAGCCTCGATACCCACCGATGCAACAACCGGGTGCAAAG
 
. : . : . : . : . : . :
rJMSF041E18+ ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACGTTGCGGTTGGGGGACTCG
rJMSF041G05+ ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACGTTGCGGTTGGGGGACTCG
rJMFF036F14+ ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACGTTGCGGTTGGGGGACTCG
rJMFF017H13+ ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACCTTGCGGTTGGGGGACTCG
rJMFF049P02+ ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACGTTGCGGTTGGGGGACTCG
                      ____________________________________________________________
consensus ATGGCTTCAAGTGGCTCGAATCCACCCAACCTAACCCCAACGTTGCGGTTGGGGGACTCG
 
. : . : . : . : . : . :
rJMSF041E18+ TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
rJMSF041G05+ TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
rJMFF036F14+ TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
rJMFF017H13+ TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
rJMFF049P02+ TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
rJMFF048P15+ CTCGATGCAAGCGG
                      ____________________________________________________________
consensus TCGGTGGACCATTTCTAAACGAGACGTATATTGATTCGAGGAACAACTCGATGCAAGCGG
 
. : . : . : . : . : . :
rJMSF041E18+ AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
rJMSF041G05+ AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
rJMFF036F14+ AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
rJMFF017H13+ AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
rJMFF049P02+ AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
rJMFF048P15+ AGCCCACGGCCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
                      ____________________________________________________________
consensus AGCCCACGACCTACAACAGTGCAATCATCGTCGGCCTTCTTTCAGGTTTGGTTACGACCT
 
. : . : . : . : . : . :
rJMSF041E18+ CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
rJMSF041G05+ CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAGTCCACCGTTATCTCGC
rJMFF036F14+ CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
rJMFF017H13+ CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
rJMFF049P02+ CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
rJMFF048P15+ CTTCAGTTGTTGGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
                      ____________________________________________________________
consensus CTTCAGTTGTTCGCTCTTTCACTTGAGGTAGGCTTCACACGCAATCCACCGTTATCTCGC
 
. : . : . : . : . : . :
rJMSF041E18+ TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
rJMSF041G05+ TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
rJMFF036F14+ TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
rJMFF017H13+ TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
rJMFF049P02+ TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
rJMFF048P15+ TCGTGTCATCGTATATATAGCTGTGTGCACACATGTCTGATAGTATATTGCATGTTTTGG
                      ____________________________________________________________
consensus TCGTGTCATCGTATATATAGCTGTGTGCACACATCTCTGATATGATATTGCATTATTTGG
 
. : . : . : . : . : . :
rJMSF041E18+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAG
rJMSF041G05+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAGT
rJMFF036F14+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAGT
rJMFF017H13+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAGT
rJMFF049P02+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAGT
rJMFF048P15+ ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAATACGTAGTTTTGTAGT
                      ____________________________________________________________
consensus ATCAACTTCTATGTTGTACCCTTATTAGTTTGTGTTTAAAGCAAAATG-AGTTTTGTAGT
 
. : . : . : . : . : . :
rJMSF041G05+ GTG
rJMFF036F14+ GTGTAAA-CATATAATCTA
rJMFF017H13+ GTGTAAACCATATAATCTATGTT
rJMFF049P02+ GTGTAAA-CATATAATCTATGTTT
rJMFF048P15+ GTGTAAA-CATATAATCTATGTTTGTGCAAGTAAAGGTTTTTATGATCTGCCAAAAAAAC
                      ____________________________________________________________
consensus GTGTAAA-CATATAATCTATGTTTGTGCAAGTAAAGGTTTTTATGATCTGCCAAAAAAAC