Previous Contig 010860:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037A03Sequence327002094 (2)sp|Q9AR73|HQGT_RAUSE4e-28Hydroquinone glucosyltransferase (EC 2.4.1.218) (Arbutin synthase).>gb:RSE310148427010860 (3)sp|Q9AR73|HQGT_RAUSE4e-44Hydroquinone glucosyltransferase (EC 2.4.1.218) (Arbutin synthase).>gb:RSE310148
JMFF040O15Sequence415010860 (3)sp|Q9AR73|HQGT_RAUSE4e-44Hydroquinone glucosyltransferase (EC 2.4.1.218) (Arbutin synthase).>gb:RSE310148
JMFF048P08Sequence449002094 (2)sp|Q9AR73|HQGT_RAUSE1e-39Hydroquinone glucosyltransferase (EC 2.4.1.218) (Arbutin synthase).>gb:RSE310148366010860 (3)sp|Q9AR73|HQGT_RAUSE5e-29Hydroquinone glucosyltransferase (EC 2.4.1.218) (Arbutin synthase).>gb:RSE310148

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040O15+ TCTCAACCACCGCTCCACCGCCGGTTTCTTGAC
rJMFF037A03+ CTCAACCACCGCTCCACCGCCGGTTTCTTGAC
                      ____________________________________________________________
consensus TCTCAACCACCGCTCCACCGCCGGTTTCTTGAC
 
. : . : . : . : . : . :
rJMFF040O15+ ACATTGTGGGTGGAATTCGACTCTGGAAAGTGTAGTCCGTGGCGTACCATTGATTGCCTG
rJMFF037A03+ ACATTGTGGGTGGAATTCGACTCTGGAAAGTGTAGTCCGTGGCGTACCATTGATTGCCTG
rJMFF048P08+ TGCCTG
                      ____________________________________________________________
consensus ACATTGTGGGTGGAATTCGACTCTGGAAAGTGTAGTCCGTGGCGTACCATTGATTGCCTG
 
. : . : . : . : . : . :
rJMFF040O15+ GCCGCTGTACGCAGAGCAGAAGATGAATGCCGTAGCGCTAACTGAGGATATAAAGGTGGC
rJMFF037A03+ GCCGCTGTACGCAGAGCAGAAGATGAATGCCGTAGCGCTAACTGAGGATATAAAGGTGGC
rJMFF048P08+ GCCGCTGTACGCAGAGCAGAAGATGAATGCCGTAGCGCTAACTGAGGATATAAAGGTGGC
                      ____________________________________________________________
consensus GCCGCTGTACGCAGAGCAGAAGATGAATGCCGTAGCGCTAACTGAGGATATAAAGGTGGC
 
. : . : . : . : . : . :
rJMFF040O15+ ACTGAGGCCAATGGGCGGTGAAAATGGGGTAGTTGGGAGAGAAGAAATCGCACAAGTTGT
rJMFF037A03+ ACTGAGGCCAATGGGCGGTGAAAATGGGGTAGTTGGGAGAGAAGAAATCGCACAAGTTGT
rJMFF048P08+ ACTGAGGCCAATGGGCGGTGAAAATGGGGTAGTTGGGAGAGAAGAAATCGCACAAGTTGT
                      ____________________________________________________________
consensus ACTGAGGCCAATGGGCGGTGAAAATGGGGTAGTTGGGAGAGAAGAAATCGCACAAGTTGT
 
. : . : . : . : . : . :
rJMFF040O15+ GAAGAGTTTAATGGAGGGTGAAGAAGGGAAGACGGTGAGACAGAGAATGAGAGAGCTAAT
rJMFF037A03+ GAAGAGTTTAATGGAGGGTGAAGAAGGGAAGACGGTGAGACAGAGAATGAGAGAGCTAAT
rJMFF048P08+ GAAGAGTTTAATGGAGGGTGAAGAAGGGAAGACGGTGAGACAGAGAATGAGAGAGCTAAT
                      ____________________________________________________________
consensus GAAGAGTTTAATGGAGGGTGAAGAAGGGAAGACGGTGAGACAGAGAATGAGAGAGCTAAT
 
. : . : . : . : . : . :
rJMFF040O15+ GGATGCAGCTGCCACGGCTCTCAGTGAAGATGGGTCTTCCACTAAAGCACTTTCTGAATT
rJMFF037A03+ GGATGCAGCTGCCACGGCTCTCAGTGAAGATGGGTCTTCCACTAAAGCACTTTCTGAATT
rJMFF048P08+ GGATGCAGCTGCCACGGCTCTCAGTGAAGATGGGTCTTCCACTAAAGCACTTTCTGAATT
                      ____________________________________________________________
consensus GGATGCAGCTGCCACGGCTCTCAGTGAAGATGGGTCTTCCACTAAAGCACTTTCTGAATT
 
. : . : . : . : . : . :
rJMFF040O15+ GGCCTCCATTTGGAAGAAGAAGATGGTAATTCCTCCATAATTGGTCCAATTATATATATT
rJMFF037A03+ GGCCTCCATTTGGAAGAAGAAGATGGTAATTCCTCCATAATTGGTCCAATTATATATATT
rJMFF048P08+ GGCCTCCATTTGGAAGAAGAAGATGGTAATTCCTCCATAATTGGTCCAATTATATATATT
                      ____________________________________________________________
consensus GGCCTCCATTTGGAAGAAGAAGATGGTAATTCCTCCATAATTGGTCCAATTATATATATT
 
. : . : . : . : . : . :
rJMFF040O15+ TACCGCTGAAAATTAAATAAGT
rJMFF037A03+ TACCGCTGAAAATTAAATAAGTTGTATCTGGGGTT
rJMFF048P08+ TACCGCTGAAAATTAAATAAGTTGTATCTGGGGTTTGATTTAATGGAAGATTCGTTTGGT
                      ____________________________________________________________
consensus TACCGCTGAAAATTAAATAAGTTGTATCTGGGGTTTGATTTAATGGAAGATTCGTTTGGT