Previous Contig 010851:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048N03Sequence416003967 (4)pir|T47631|T476311e-20Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha351010851 (2)
JMSF035H08Sequence630003967 (4)pir|T47631|T476311e-24Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha736010851 (2)pir|T47631|T476315e-27Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035H08+ AGCCTGAGT
                      ____________________________________________________________
consensus AGCCTGAGT
 
. : . : . : . : . : . :
rJMSF035H08+ GGTGTATTGGAAGGAGGTGTCTCGTTAGATCCAATTTTCGATGCCATTCGGGAGCTTACT
                      ____________________________________________________________
consensus GGTGTATTGGAAGGAGGTGTCTCGTTAGATCCAATTTTCGATGCCATTCGGGAGCTTACT
 
. : . : . : . : . : . :
rJMSF035H08+ GCTGCGGCTAAAGCTATTGAGGAAGAAGCAAAGAAACTAAGGAAGGATGAAACCATGGCT
                      ____________________________________________________________
consensus GCTGCGGCTAAAGCTATTGAGGAAGAAGCAAAGAAACTAAGGAAGGATGAAACCATGGCT
 
. : . : . : . : . : . :
rJMSF035H08+ GAACTTTTGATATTGGAGCGGCGGATGCTAAACGATCGCCTAATGTCTGCCGAGAGAGGT
                      ____________________________________________________________
consensus GAACTTTTGATATTGGAGCGGCGGATGCTAAACGATCGCCTAATGTCTGCCGAGAGAGGT
 
. : . : . : . : . : . :
rJMSF035H08+ TTCTTAAATACCGAGGGGGTTAACGGAAGGCAATGGTTCAAGCATCTTGTTTATGGACCG
                      ____________________________________________________________
consensus TTCTTAAATACCGAGGGGGTTAACGGAAGGCAATGGTTCAAGCATCTTGTTTATGGACCG
 
. : . : . : . : . : . :
rJMSF035H08+ AGCACCGGTGGTGAAACCGAGCTAGATTTCTTCCCCGGAATAGTTGATGCTGTTTCGCGA
                      ____________________________________________________________
consensus AGCACCGGTGGTGAAACCGAGCTAGATTTCTTCCCCGGAATAGTTGATGCTGTTTCGCGA
 
. : . : . : . : . : . :
rJMSF035H08+ TCGACGCATCTAAACAACACAGAAAGGGGGGCAATAATCCAGCATGAAATCTGGAGAGTT
                      ____________________________________________________________
consensus TCGACGCATCTAAACAACACAGAAAGGGGGGCAATAATCCAGCATGAAATCTGGAGAGTT
 
. : . : . : . : . : . :
rJMSF035H08+ GCAAGGGCTATCCAAAGAGCTGCCTATGCTCTCAAAGGCAATCTAACCTGAGTACCTGAC
                      ____________________________________________________________
consensus GCAAGGGCTATCCAAAGAGCTGCCTATGCTCTCAAAGGCAATCTAACCTGAGTACCTGAC
 
. : . : . : . : . : . :
rJMSF035H08+ AGACAACCTTGTTCATGATGTGTTGTAAGGTCGTACATTTTCAGAAAGGCTGTTTGGTTT
rJMFF048N03+ TGTTCATGATGTGTGGTAAGGTCGTACATTTTCAGAAAGGCTGTTTGGTTT
                      ____________________________________________________________
consensus AGACAACCTTGTTCATGATGTGTTGTAAGGTCGTACATTTTCAGAAAGGCTGTTTGGTTT
 
. : . : . : . : . : . :
rJMSF035H08+ GGCTGGCAAAAATTTTGCAGAATACATCGCGCCAGGTAGGGGTCGAACCTACGACTTTCT
rJMFF048N03+ GGCTGGCAAAAATTTTGCAGAATACATCGCGCCAGGTAGGGGTCGAACCTACGACTTTCT
                      ____________________________________________________________
consensus GGCTGGCAAAAATTTTGCAGAATACATCGCGCCAGGTAGGGGTCGAACCTACGACTTTCT
 
. : . : . : . : . : . :
rJMSF035H08+ GCTTAGGAAACAGACGCTCTATCCACTGAGCTACAGGCGCTGGTTGTGAGTGTGAGCATA
rJMFF048N03+ GCTTAGGAAACAGACGCTCTATCCACTGAGCTACAGGCGCTGGTTGTGAGTGTGAGCATA
                      ____________________________________________________________
consensus GCTTAGGAAACAGACGCTCTATCCACTGAGCTACAGGCGCTGGTTGTGAGTGTGAGCATA
 
. : . : . : . : . : . :
rJMSF035H08+ GTTTGTCTATAAAACTTTAAAATACTATGATTGATCAATTGCCAACTAAAGTGCCCAAAA
rJMFF048N03+ GTTTGTCTATAAAACTTTAAAATACTATGATTGATCAATTGCCAACTAAAGTGCCCAAAA
                      ____________________________________________________________
consensus GTTTGTCTATAAAACTTTAAAATACTATGATTGATCAATTGCCAACTAAAGTGCCCAAAA
 
. : . : . : . : . : . :
rJMSF035H08+ AATGGTCGAATGGATAAAGAATGGCTCTCATATAAGAATGTCACAAGTTTGGTTGTTGTC
rJMFF048N03+ AATGGTCGAATGGATAAAGAATGGCTCTCATATAAGAATGTCACAAGTTTGGTTGTTGTC
                      ____________________________________________________________
consensus AATGGTCGAATGGATAAAGAATGGCTCTCATATAAGAATGTCACAAGTTTGGTTGTTGTC
 
. : . : . : . : . : . :
rJMSF035H08+ TATACTT
rJMFF048N03+ TATACTTTCTTGGACTTTATAATGTAATTTTTTACTTCTCTTGTGCAATTACTTTTCAAC
                      ____________________________________________________________
consensus TATACTTTCTTGGACTTTATAATGTAATTTTTTACTTCTCTTGTGCAATTACTTTTCAAC