Previous Contig 010845:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048M09Sequence625005442 (4)gb:AB018112_15137812e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.>gb:AY056234_1563575010845 (4)gb:AJ635428_18133532e-44Cucumis sativus mRNA for putative translation releasing factor 2 (rf2 gene).
JMSF010A05Sequence262005442 (4)796010845 (4)gb:AJ635428_1813353e-110Cucumis sativus mRNA for putative translation releasing factor 2 (rf2 gene).
JMSF014A03Sequence293005442 (4)778010845 (4)gb:AJ635428_18133532e-99Cucumis sativus mRNA for putative translation releasing factor 2 (rf2 gene).
JMSF049P23Sequence688005442 (4)gb:AJ635428_18133539e-25Cucumis sativus mRNA for putative translation releasing factor 2 (rf2 gene).664010845 (4)gb:AJ635428_18133533e-69Cucumis sativus mRNA for putative translation releasing factor 2 (rf2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010A05+ TATGTGAGATGGGGAGAGAAGCAGCNGTACAGAACCAAAGTAGTTGAGAA
                      ____________________________________________________________
consensus TATGTGAGATGGGGAGAGAAGCAGCNGTACAGAACCAAAGTAGTTGAGAA
 
. : . : . : . : . : . :
rJMSF010A05+ GTCTCCTGGAGAAGAGGCTGGGATTAAATCAGCTACAGTTGAAGNTGAAGGTCGATATGC
rJMSF014A03+ GGGATTAANTCAGCTACAGTTGAAGTTGAAGGTCGATATGC
                      ____________________________________________________________
consensus GTCTCCTGGAGAAGAGGCTGGGATTAAATCAGCTACAGTTGAAGTTGAAGGTCGATATGC
 
. : . : . : . : . : . :
rJMSF010A05+ ATATGGTTATTTATCTGGAGAGAAAGGAACCCATAGAATTGTGCGACAATCTCCTTTCAA
rJMSF014A03+ ATATGGTTATTTATCTGGAGAGAAAGGAACCCATAGAATTGTGCGACAATCTCCTTTCAA
                      ____________________________________________________________
consensus ATATGGTTATTTATCTGGAGAGAAAGGAACCCATAGAATTGTGCGACAATCTCCTTTCAA
 
. : . : . : . : . : . :
rJMSF010A05+ TGCTAAAGGCCTTCGCCAGACAAGCTTCTCTGGTGTCGAGGTCATGCCTCTTCTTCCCGA
rJMSF014A03+ TGCTAAAGGCCTTCGCCAGACAAGCTTCTCTGGTGTCGAGGTCATGCCTCTTCTTCCCGA
                      ____________________________________________________________
consensus TGCTAAAGGCCTTCGCCAGACAAGCTTCTCTGGTGTCGAGGTCATGCCTCTTCTTCCCGA
 
. : . : . : . : . : . :
rJMSF010A05+ GGACTCAACAGATGTCGAAATACCAGATGAAGACTTGGATATCAGTTTTACCAGAGCAGG
rJMSF014A03+ GGACTCAACAGATGTCGAAATACCAGATGAAGACTTGGATATCAGTTTTACCAGAGCAGG
rJMSF049P23+ GACTCAACAGATGTCGAAATACCAGATGAAGACTTGGATATCAGTTTTACCAGAGCAGG
                      ____________________________________________________________
consensus GGACTCAACAGATGTCGAAATACCAGATGAAGACTTGGATATCAGTTTTACCAGAGCAGG
 
. : . : . : . : . : . :
rJMSF010A05+ CGGGAAAGGAGGTCAAAATGTTAACAAGGTTGAAACAGCAGTGCGCATTACACATATCCC
rJMSF014A03+ CGGGAAAGGAGGTCAAAATGTTAACAAGGTTGAAACAGCAGTGCGCATTACACATATCCC
rJMSF049P23+ CGGGAAAGGAGGTCAAAATGTTAACAAGGTTGAAACAGCAGTGCGCATTACACATATCCC
                      ____________________________________________________________
consensus CGGGAAAGGAGGTCAAAATGTTAACAAGGTTGAAACAGCAGTGCGCATTACACATATCCC
 
. : . : . : . : . : . :
rJMSF010A05+ CACTGGTGTAGCCGTCCGTTGTACAGAAGAGAGAACACAACTAGCGAACAAGATAAAGGC
rJMSF014A03+ CACTGGTGTAGCCGTCCGTTGTACAGAAGAGAGAACACAACTAGCGAACAAGATAAAGGC
rJMSF049P23+ CACTGGTGTAGCCGTCCGTTGTACAGAAGAGAGAACACAACTAGCGAACAAGATAAAGGC
rJMFF048M09+ CAGAAGAGAGAACACAACTAGCGAACAAGATAAAGGC
                      ____________________________________________________________
consensus CACTGGTGTAGCCGTCCGTTGTACAGAAGAGAGAACACAACTAGCGAACAAGATAAAGGC
 
. : . : . : . : . : . :
rJMSF010A05+ TCTGAGCCGATTGAAAGCCAAACTGCTAGTCATAGCCGAGGAACAAAGAGCGTCTGAAAT
rJMSF014A03+ TCTGAGCCGATTGAAAGCCAAACTGCTAGTCATAGCCGAGGAACAAAGAGCGTCTGAAAT
rJMSF049P23+ TCTGAGCCGATTGAAAGCCAAACTGCTAGTCATAGCCGAGGAACAAAGAGCGTCTGAAAT
rJMFF048M09+ TCTGAGCCGATTGAAAGCCAAACTGCTAGTCATAGCCGAGGAACAAAGAGCGTCTGAAAT
                      ____________________________________________________________
consensus TCTGAGCCGATTGAAAGCCAAACTGCTAGTCATAGCCGAGGAACAAAGAGCGTCTGAAAT
 
. : . : . : . : . : . :
rJMSF010A05+ AAAGCAAATAAGAGGGGATGCGGTGAAGGCAGAGTGGGGGCAACAAATACGGAACTACGT
rJMSF014A03+ AAAGCAAATAAGAGGGGATGCGGTGAAGGCAGAGTGGGGGCAACAAATACGGAACTACGT
rJMSF049P23+ AAAGCAAATAAGAGGGGATGCGGTGAAGGCAGAGTGGGGGCAACAAATACGGAACTACGT
rJMFF048M09+ AAAGCAAATAAGAGGGGATGCGGTGAAGGCAGAGTGGGGGCAACAAATACGGAACTACGT
                      ____________________________________________________________
consensus AAAGCAAATAAGAGGGGATGCGGTGAAGGCAGAGTGGGGGCAACAAATACGGAACTACGT
 
. : . : . : . : . : . :
rJMSF010A05+ GTTTCATCCTTACAAGCTGGTGAAAGATGTTTGGACCGGGTATGAAACTTCAGACATCAC
rJMSF014A03+ GTTTCATCCTTACAAGCTGGTGAAAGATGTTCGGACCGGGTATGAAACTTCAGACATCAC
rJMSF049P23+ GTTTCATCCTTACAAGCTGGTGAAAGATGTTCGGACCGGGTATGAAACTTCAGACATCAC
rJMFF048M09+ GTTTCATCCTTACAAGCTGGTGAAAGATGTTCGGACCGGGTATGAAACTTCAGACATCAC
                      ____________________________________________________________
consensus GTTTCATCCTTACAAGCTGGTGAAAGATGTTCGGACCGGGTATGAAACTTCAGACATCAC
 
. : . : . : . : . : . :
rJMSF010A05+ TTCTGTAATGGATGGGGAGCTAGATCCCTTCATTAGATCCTTCCTCAAGTACAAGTACAG
rJMSF014A03+ TTCTGTAATGGATGGGGAGCTAGATCCCTTCATTAGATCCTTCCTCAAGTACAAGTACAG
rJMSF049P23+ TTCTGTAATGGATGGGGAGCTAGATCCCTTCATTAGATCCTTCCTCAAGTACAAGTACAG
rJMFF048M09+ TTCTGTAATGGATGGGGAGCTAGATCCCTTCATTAGATCCTTCCTCAAGTACAAGTACAG
                      ____________________________________________________________
consensus TTCTGTAATGGATGGGGAGCTAGATCCCTTCATTAGATCCTTCCTCAAGTACAAGTACAG
 
. : . : . : . : . : . :
rJMSF010A05+ CATGTCAATGTCCTCTGGTGGAGAATAGATTCTGTGCAAAGTTGAGTAGTCTCATCAGTC
rJMSF014A03+ CATGTCAATGTCCTCTGGTGGAGAATAGATTCTGTGCAAAGTTGAGTAGTCTCATCAGTC
rJMSF049P23+ CATGTCAATGTCCTCTGGTGGAGAATAGATTCTGTGCAAAGTTGAGTAGTCTCATCAGTC
rJMFF048M09+ CATGTCAATGTCCTCTGGTGGAGAATAGATTCTGTGCAAAGTTGAGTAGTCTCATCAGTC
                      ____________________________________________________________
consensus CATGTCAATGTCCTCTGGTGGAGAATAGATTCTGTGCAAAGTTGAGTAGTCTCATCAGTC
 
. : . : . : . : . : . :
rJMSF010A05+ ATTAGTACTCCCCAAAAATCCACCAAAATGGGGATGCCATGGAAGTTTTGGTGTATCAAT
rJMSF014A03+ ATTAGTACTCCCCAAAAATCCACCAAAATGGGGATGCCATGGAAGTTTTGGTGTATCAAT
rJMSF049P23+ ATTAGTACTCCCCAAAAATCCACCAAAATGGGGATGCCATGGAAGTTTTGGTGTATCAAT
rJMFF048M09+ ATTAGTACTCCCCAAAAATCCACCAAAATGGGGATGCCATGGAAGTTTTGGTGTATCAAT
                      ____________________________________________________________
consensus ATTAGTACTCCCCAAAAATCCACCAAAATGGGGATGCCATGGAAGTTTTGGTGTATCAAT
 
. : . : . : . : . : . :
rJMSF010A05+ CAATTGCCAGTGTGATGAAATAACAA
rJMSF014A03+ CAATTG-CAGTGTGATGAAATAACAATTTATATATAATAGGGAAATCTGCCATTTGTTGT
rJMSF049P23+ CAATTG-CAGTGTGATGAAATAACAATTTATATATAATAGGGAAATCTGCCATTTGTTGT
rJMFF048M09+ CAATTG-CAGTGTGATGAAATAACAATTTATATATAATAGGGAAATCTGCCATTTGTTGT
                      ____________________________________________________________
consensus CAATTG-CAGTGTGATGAAATAACAATTTATATATAATAGGGAAATCTGCCATTTGTTGT
 
. : . : . : . : . : . :
rJMSF014A03+ GTGTTCCATGGTGAGATT
rJMSF049P23+ GTGTT-CATGGTGAGATTTCACCCACTCACGACCTGACCCCTTTGATCGATGTTCTCAAA
rJMFF048M09+ GTGTT-CATGGTGAGATTTCACCCACTCACGACCTGACCCCTTTGATCGATGTTCTCAAA
                      ____________________________________________________________
consensus GTGTT-CATGGTGAGATTTCACCCACTCACGACCTGACCCCTTTGATCGATGTTCTCAAA
 
. : . : . : . : . : . :
rJMSF049P23+ AGAAAAA
rJMFF048M09+ AGAAAAACTTATGTCAATTGCATTTTACTTACTAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AGAAAAACTTATGTCAATTGCATTTTACTTACTAAAAAAAAAAAAAAAACTCTCCAGGGT