Previous Contig 010841:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048M02Sequence431015089gb:OSJN00104_16949874e-23Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque255010841 (2)
JMFN016A01Sequence542010841 (2)gb:OSJN00104_16949871e-44Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016A01- GTAAACAGGAAAACGGGC
                      ____________________________________________________________
consensus GTAAACAGGAAAACGGGC
 
. : . : . : . : . : . :
JMFN016A01- ATTCTTCCATGTATACTTGGATATTGAGCACAGGTTGGTGGAAAGGACGAGCTCCAATCA
                      ____________________________________________________________
consensus ATTCTTCCATGTATACTTGGATATTGAGCACAGGTTGGTGGAAAGGACGAGCTCCAATCA
 
. : . : . : . : . : . :
JMFN016A01- ACCCCGATGCTGTTGTAGTAATAAGCCTTTTGTGCACATTCCTGCTTGGTGGCTTTGTAT
                      ____________________________________________________________
consensus ACCCCGATGCTGTTGTAGTAATAAGCCTTTTGTGCACATTCCTGCTTGGTGGCTTTGTAT
 
. : . : . : . : . : . :
JMFN016A01- ACATTAACAGAGTGAAGCCTCTAAAAGCGCTGAAGAAACAATCATATCAATCGGCGAGAC
                      ____________________________________________________________
consensus ACATTAACAGAGTGAAGCCTCTAAAAGCGCTGAAGAAACAATCATATCAATCGGCGAGAC
 
. : . : . : . : . : . :
JMFN016A01- TGATCTTGGTAGTTGCAAGTTTGTATTGTTTATGGTGTGCGAGCCAAATATATTTGGTTA
                      ____________________________________________________________
consensus TGATCTTGGTAGTTGCAAGTTTGTATTGTTTATGGTGTGCGAGCCAAATATATTTGGTTA
 
. : . : . : . : . : . :
JMFN016A01- GCCCTCGCAGGCCAGCAGTCGGTGAAGAAGCTGATTTGGGTGTTCTCGTGTTTCTTGCTG
rJMFF048M02+ TCGTGTTTCTTGCTG
                      ____________________________________________________________
consensus GCCCTCGCAGGCCAGCAGTCGGTGAAGAAGCTGATTTGGGTGTTCTCGTGTTTCTTGCTG
 
. : . : . : . : . : . :
JMFN016A01- TGTATTTTTTTCTTCCTCACTGGCTTTGTGTTCTCTCCATGAACTCGACCGATTCCCATG
rJMFF048M02+ TGTATTTTTTTCTTCCTCACTGGCTTTGTGTTCTCTCCATGAACTCGACCGATTCCCATG
                      ____________________________________________________________
consensus TGTATTTTTTTCTTCCTCACTGGCTTTGTGTTCTCTCCATGAACTCGACCGATTCCCATG
 
. : . : . : . : . : . :
JMFN016A01- GCACAGAAGTACTGCCACTTTAACAGTTATTCAAAATTAGTTTGTAAACCAATTACCTAT
rJMFF048M02+ GCACAGAAGTACTGCCACTTTAACAGTTATTCAAAATTAGTTTGTAAACCAATTACCTAT
                      ____________________________________________________________
consensus GCACAGAAGTACTGCCACTTTAACAGTTATTCAAAATTAGTTTGTAAACCAATTACCTAT
 
. : . : . : . : . : . :
JMFN016A01- ATTGGTTTCTAAGCTCATAATGTGTTGTCTTGTAGTCCTAATGATTTTGGATATTGGAGA
rJMFF048M02+ ATTGGTTTCTAAGCTCATAATGTGTTGTCTGGTAGTCCTAATGATTTTGGATATTGGAGA
                      ____________________________________________________________
consensus ATTGGTTTCTAAGCTCATAATGTGTTGTCTTGTAGTCCTAATGATTTTGGATATTGGAGA
 
. : . : . : . : . : . :
JMFN016A01- AACCATCATGGCTTTATGAGAAGTTCATTCACTCTCTTCAAACT
rJMFF048M02+ AACCATCATGGCTTTATGAGAAGTTCATTCACTCTCTTCAAACTAAAAAAAAAAAAAAAG
                      ____________________________________________________________
consensus AACCATCATGGCTTTATGAGAAGTTCATTCACTCTCTTCAAACTAAAAAAAAAAAAAAAG