Previous Contig 010839:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027G02Sequence611002079 (5)gb:AP003990_18360183e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10618010839 (5)gb:AP003990_18360188e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF029A19Sequence430002079 (5)721010839 (5)gb:AP003990_18360181e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF042C02Sequence659002079 (5)gb:AP003990_18360181e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10571010839 (5)gb:AP003990_18360182e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF048L19Sequence426002079 (5)215010839 (5)
JMFF050P05Sequence565002079 (5)gb:AP003990_18360188e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10318010839 (5)gb:AP003990_18360183e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029A19+ CTTGCTCCTCCAGCTACTTTC
                      ____________________________________________________________
consensus CTTGCTCCTCCAGCTACTTTC
 
. : . : . : . : . : . :
rJMFF029A19+ AGCGGATGTACATCTCCCACAAGGATGTCGGGTTGTCGCAGGTTTGGCCTCGCCACCAAG
                      ____________________________________________________________
consensus AGCGGATGTACATCTCCCACAAGGATGTCGGGTTGTCGCAGGTTTGGCCTCGCCACCAAG
 
. : . : . : . : . : . :
rJMFF027G02+ CTCCTAATGCTAGATACAGGCTAGCATTCTATGCTGGGCGAGCGC
rJMFF029A19+ AACAAATCTTGAATCCTCCTAATGCTAGATACAGGCTAGCATTCTATGCTGGGCGAGCGC
                      ____________________________________________________________
consensus AACAAATCTTGAATCCTCCTAATGCTAGATACAGGCTAGCATTCTATGCTGGGCGAGCGC
 
. : . : . : . : . : . :
rJMFF027G02+ AAAACTCACGCACAAGGCAATGGCTGATCGATCTGTGGAAGAACGACTCTGCATTCGACA
rJMFF029A19+ AAAACTCACGCACAAGGCAATGGCTGATCGATCTGTGGAAGAACGACTCTGCATTCGACA
rJMFF042C02+ CTGATCGATCTGTGGAAGAACGACTCTGCATTCGACA
                      ____________________________________________________________
consensus AAAACTCACGCACAAGGCAATGGCTGATCGATCTGTGGAAGAACGACTCTGCATTCGACA
 
. : . : . : . : . : . :
rJMFF027G02+ TATTCCCCGGGAGTTCTTCGTTTCCATATGCAGAAGGGTTCCGTAGAAGCAAATATTGCC
rJMFF029A19+ TATTCCCCGGGAGTTCTTCGTTTCCATATGCAGAAGGGTTCCGTAGAAGCAAATATTGCC
rJMFF042C02+ TATTCCCCGGGAGTTCTTCGTTTCCATATGCAGAAGGGTTCCGTAGAAGCAAATATTGCC
                      ____________________________________________________________
consensus TATTCCCCGGGAGTTCTTCGTTTCCATATGCAGAAGGGTTCCGTAGAAGCAAATATTGCC
 
. : . : . : . : . : . :
rJMFF027G02+ TGCACGTTAAGGGGTACGAGGTGAACACCGCGAGGGTGAGTGATGCTATACACTATGGGT
rJMFF029A19+ TGCACGTTAAGGGGTACGAGGTGAACACCGCGAGGGTGAGTGATGCTATACACTATGGGT
rJMFF042C02+ TGCACGTTAAGGGGTACGAGGTGAACACCGCGAGGGTGAGTGATGCTATACACTATGGGT
                      ____________________________________________________________
consensus TGCACGTTAAGGGGTACGAGGTGAACACCGCGAGGGTGAGTGATGCTATACACTATGGGT
 
. : . : . : . : . : . :
rJMFF027G02+ GCATCCCGGTTCTGATCTCGAATCACTACGAACTCCCTTTCGCCAACGTATTGGACTGGA
rJMFF029A19+ GCATCCCGGTTCTGATCTCGAATCACTACGAACTCCCTTTCGCCAACGTATTGGACTGGA
rJMFF042C02+ GCATCCCGGTTCTGATCTCGAATCACTACGAACTCCCTTTCGCCAACGTATTGGACTGGA
                      ____________________________________________________________
consensus GCATCCCGGTTCTGATCTCGAATCACTACGAACTCCCTTTCGCCAACGTATTGGACTGGA
 
. : . : . : . : . : . :
rJMFF027G02+ CAAAGTTCTCGGTGATTCTCAACGAAGGAGACATCCCCATGTTGAAGAAGATACTGCTAT
rJMFF029A19+ CAAAGTTCTCGGTGATTCTCAACGAAGGAGACATCCCCATGTTGAAGAAGATACTGCTAT
rJMFF050P05+ CCATGTTGAAGAAGATACTGCTAT
rJMFF042C02+ CAAAGTTCTCGGTGATTCTCAACGAAGGAGACATCCCCATGTTGAAGAAGATACTGCTAT
                      ____________________________________________________________
consensus CAAAGTTCTCGGTGATTCTCAACGAAGGAGACATCCCCATGTTGAAGAAGATACTGCTAT
 
. : . : . : . : . : . :
rJMFF027G02+ CGATTCCCGAGCAAACATACCTCAACTTGTACAAGAATGTTGGTATAGTCCGAAAGCATT
rJMFF029A19+ CGATTCCCGAGCAAACATACCTCAACTTGTACAAGAATGTTGGTATAGTCCGAAAGCATT
rJMFF050P05+ CGATTCCCGAGCAAACATACCTCAACTTGTACAAGAATGTTGGTATAGTCCGAAAGCATT
rJMFF042C02+ CGATTCCCGAGCAAACATACCTCAACTTGTACAAGAATGTTGGTATAGTCCGAAAGCATT
                      ____________________________________________________________
consensus CGATTCCCGAGCAAACATACCTCAACTTGTACAAGAATGTTGGTATAGTCCGAAAGCATT
 
. : . : . : . : . : . :
rJMFF027G02+ TTGCATGGCATATGACACCCAAGAATTATGATTCTTTCTATATGACAGTGTACCAGTTGT
rJMFF029A19+ TTGCATGGCATATGACACCCAAGAATTATGATTCTTTCTATATGACAGTGTACCAGTTGT
rJMFF050P05+ TTGCATGGCATATGACACCCAAGAATTATGATTCTTTCTATATGACAGTGTACCAGTTGT
rJMFF042C02+ TTGCATGGCATATGACACCCAAGAATTATGATTCTTTCTATATGACAGTGTACCAGTTGT
                      ____________________________________________________________
consensus TTGCATGGCATATGACACCCAAGAATTATGATTCTTTCTATATGACAGTGTACCAGTTGT
 
. : . : . : . : . : . :
rJMFF027G02+ GGCTCAGAAGGGGGCTCACCCGAGTAGCCTGGTGATGATGATCAACATGTCTAGTTACAC
rJMFF029A19+ GGCTCAGAAGGGGGCTCACCCGAGTAGCCTGGTGATGATGATCAACATGTCTAGTTACAC
rJMFF050P05+ GGCTCAGAAGGGGGCTCACCCGAGTAGCCTGGTGATGATGATCAACATGTTTAGTTACAC
rJMFF042C02+ GGCTCAGAAGGGGGCTCACCCGAGTAGCCTGGTGATGATGATCAACATGTCTAGTTACAC
rJMFF048L19+ AGCCTGGTGATGATGATCAACATGTCTAGTTACAC
                      ____________________________________________________________
consensus GGCTCAGAAGGGGGCTCACCCGAGTAGCCTGGTGATGATGATCAACATGTCTAGTTACAC
 
. : . : . : . : . : . :
rJMFF027G02+ CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
rJMFF029A19+ CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
rJMFF050P05+ CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
rJMFF042C02+ CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
rJMFF048L19+ CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
                      ____________________________________________________________
consensus CGAGTACTGCCAGGCCGGACACAAACATTAGGTATACTTGTTAGGATCGTTGACACTATA
 
. : . : . : . : . : . :
rJMFF027G02+ GAAATTTCCTTTTCCTCAATAAATGGT
rJMFF029A19+ GAAATTTCCTTTTCCTCAATAAATGG-TGAAAAATAGAA
rJMFF050P05+ GAAATTTCCTTTTCCTCAATAAATGGTTGAAAAATAGAATGAACTAGGTTCA
rJMFF042C02+ GAAATTTCCTTTTCCTCAATAAATGGTTGAAAAATAGAATGAACTAGGTTCA
rJMFF048L19+ GAAATTTCCTTTTCCTCAATAAATGGTTGAAAAATAGAATGAACTAGGTTCAACAATAGA
                      ____________________________________________________________
consensus GAAATTTCCTTTTCCTCAATAAATGGTTGAAAAATAGAATGAACTAGGTTCAACAATAGA
 
. : . : . : . : . : . :
rJMFF048L19+ GTTTCAAGCACCACCATTGTTAAATAAAAGGCAAAATTTCTTTGCCAAAAAAAAAAAAAG
                      ____________________________________________________________
consensus GTTTCAAGCACCACCATTGTTAAATAAAAGGCAAAATTTCTTTGCCAAAAAAAAAAAAAG