Previous Contig 010838:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048L14Sequence484004138 (5)gb:LEU28007_16847269e-33Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.418010838 (3)gb:AF249317_17806966e-09Glycine max Pti1 kinase-like protein (Pti1a) mRNA, complete cds.
JMFN039A05Sequence475010838 (3)gb:AF249317_17806962e-19Glycine max Pti1 kinase-like protein (Pti1a) mRNA, complete cds.
JMSF023M05Sequence668004138 (5)gb:LEU28007_16847262e-65Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.790010838 (3)gb:AC087552_17341002e-83Oryza sativa (japonica cultivar-group) chromosome 5 clone P0519E07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023M05+ CTGCAAAGGGACTAGN
                      ____________________________________________________________
consensus CTGCAAAGGGACTAGN
 
. : . : . : . : . : . :
rJMSF023M05+ ATACTTGCACGAGNAGACGCAGCCTCACATCATTCATCGTGATATTAAGTCTAGCAATGT
                      ____________________________________________________________
consensus ATACTTGCACGAGNAGACGCAGCCTCACATCATTCATCGTGATATTAAGTCTAGCAATGT
 
. : . : . : . : . : . :
rJMSF023M05+ TTTACTTTTCGACGACGATGTTGCTAAGATTGCAGATTTNGACTTATCAAACCAAGCCCC
                      ____________________________________________________________
consensus TTTACTTTTCGACGACGATGTTGCTAAGATTGCAGATTTNGACTTATCAAACCAAGCCCC
 
. : . : . : . : . : . :
rJMSF023M05+ TGACATGGCAGCACGCCTTCATTCCACCCGTGTTCTCGGGACTTTTGGTTATCATGCTCC
                      ____________________________________________________________
consensus TGACATGGCAGCACGCCTTCATTCCACCCGTGTTCTCGGGACTTTTGGTTATCATGCTCC
 
. : . : . : . : . : . :
rJMSF023M05+ TGAGTATGCAATGACTGGTCAATTGAATTCGAAGAGCGATGTTTACAGCTTTGGTGTCGT
                      ____________________________________________________________
consensus TGAGTATGCAATGACTGGTCAATTGAATTCGAAGAGCGATGTTTACAGCTTTGGTGTCGT
 
. : . : . : . : . : . :
rJMSF023M05+ TCTCCTTGAACTACTAACTGGCCGTAAACCCGTTGATCACACTTTGCCTCGTGGACAACA
                      ____________________________________________________________
consensus TCTCCTTGAACTACTAACTGGCCGTAAACCCGTTGATCACACTTTGCCTCGTGGACAACA
 
. : . : . : . : . : . :
rJMSF023M05+ GAGTCTTGTAACATGGGCGACACCGAGGTTGAGCGAAGACAAAGTGAAGCAGTGCGTTGA
JMFN039A05- GAGGTTGAGCGAAGACAAAGTGAAGCAGTGCGTTGA
                      ____________________________________________________________
consensus GAGTCTTGTAACATGGGCGACACCGAGGTTGAGCGAAGACAAAGTGAAGCAGTGCGTTGA
 
. : . : . : . : . : . :
rJMSF023M05+ TGCTAGACTGAACGGGGAATACCCTCCCAAGGCAGTTGCAAAGATGGCTGCGGTAGCTGC
JMFN039A05- TGCTAGACTGAACGGGGAATACCCTCCCAAGGCAGTTGCAAAGATGGCTGCGGTAGCTGC
                      ____________________________________________________________
consensus TGCTAGACTGAACGGGGAATACCCTCCCAAGGCAGTTGCAAAGATGGCTGCGGTAGCTGC
 
. : . : . : . : . : . :
rJMSF023M05+ CTTGTGCGTGCAATACGAAGCAGATTTCCGACCAAATATGAGCATCGTGGTAAAGGCTCT
JMFN039A05- CTTGTGCGTGCAATACGAAGCAGATTTCCGACCAAATATGAGCATCGTGGTAAAGGCTCT
rJMFF048L14+ TGTGCGTGCAATACGAAGCAGATTTCCGACCAAATATGAGCATCGTGGTAAAGGCTCT
                      ____________________________________________________________
consensus CTTGTGCGTGCAATACGAAGCAGATTTCCGACCAAATATGAGCATCGTGGTAAAGGCTCT
 
. : . : . : . : . : . :
rJMSF023M05+ TCAACCTCTACTGAACGCTCGAGCTGGGCATTCCAGCGACACGCCAAACCTGTGAATTCC
JMFN039A05- TCAACCTCTACTGAACGCTCGAGCTGGGCATTCCAGCGACACGCCAAACCTGTGAATTCC
rJMFF048L14+ TCAACCTCTACTGAACGCTCGAGCTGGGCATTCCAGCGACACGCCAAACCTGTGAATTCC
                      ____________________________________________________________
consensus TCAACCTCTACTGAACGCTCGAGCTGGGCATTCCAGCGACACGCCAAACCTGTGAATTCC
 
. : . : . : . : . : . :
rJMSF023M05+ TCCTGTTTTTTAACCCCAAATGCCTTAAGGGTTGAGATTATTTTGTTATGAAGTGTTTGA
JMFN039A05- TCCTGTTTTTTAACCCCAAATGCCTTAAGGGTTGAGATTATTTTGTTATGAAGTGTTTGA
rJMFF048L14+ TCCTGTTTTTTAACCCCAAATGCCTTAAGGGTTGAGATTATTTTGTTATGAAGTGTTTGA
                      ____________________________________________________________
consensus TCCTGTTTTTTAACCCCAAATGCCTTAAGGGTTGAGATTATTTTGTTATGAAGTGTTTGA
 
. : . : . : . : . : . :
rJMSF023M05+ AGATCCTGCAACATGTGAATCAGGGACAATTCTTTCTGTTTGGTTTTTCTTCCCCACCAT
JMFN039A05- AGATCCTGCAACATGTGAATCAGGGACAATTCTTTCTGTTTGGTTTTTCTTCCCCACCAT
rJMFF048L14+ AGATCCTGCAACATGTGAATCAGGGACAATTCTTTCTGTTTGGTTTTTCTTCCCCACCAT
                      ____________________________________________________________
consensus AGATCCTGCAACATGTGAATCAGGGACAATTCTTTCTGTTTGGTTTTTCTTCCCCACCAT
 
. : . : . : . : . : . :
rJMSF023M05+ TTTGATGCATAGAATTATTATAATTATAATTATTATTATTATTATTATTATTATGTAGAT
JMFN039A05- TTTGATGCATAGAATTATTATAATTATAATTATTATTATTATTATTATTATTATGTAGAT
rJMFF048L14+ TTTGATGCATAGAATTATTATAATTATAATTATTATTATTATTATTATTATTATGTAGAT
                      ____________________________________________________________
consensus TTTGATGCATAGAATTATTATAATTATAATTATTATTATTATTATTATTATTATGTAGAT
 
. : . : . : . : . : . :
rJMSF023M05+ GCACAAGACCAAAACTNCATTGATGTCATTCCTCCCAGAT
JMFN039A05- GCACAAGACCAAAACTGCATTGATGTCATTCCTCCCAGATTGTATTGTATTTTTATAAAT
rJMFF048L14+ GCACAAGACCAAAACTGCATTGATGTCATTCCTCCCAGATTGTATTGTATTTTTATAAAT
                      ____________________________________________________________
consensus GCACAAGACCAAAACTGCATTGATGTCATTCCTCCCAGATTGTATTGTATTTTTATAAAT
 
. : . : . : . : . : . :
JMFN039A05- ATAATAATAGTTTCAACTC
rJMFF048L14+ ATAATATTAGTTTCAACTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATAATATTAGTTTCAACTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG