Previous Contig 010835:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040O04Sequence495005024 (8)pir|B86299|B862991e-45hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops742010835 (8)
JMFF048K13Sequence510005024 (8)pir|B86299|B862994e-47hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops369010835 (8)
JMSF008L05Sequence401005024 (8)pir|B86299|B862996e-30hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops783010835 (8)pir|B86299|B862999e-62hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops
JMSF015E10Sequence262005024 (8)pir|B86299|B862998e-17hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops801010835 (8)pir|B86299|B862991e-57hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops
JMSF015M16Sequence472005024 (8)pir|B86299|B862991e-39hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops773010835 (8)pir|B86299|B862995e-58hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops
JMSF024B07Sequence659005024 (8)pir|T01019|T010191e-53transport protein homolog YUP8H12R.2 - Arabidopsis thaliana>gb:AE005173_895457 A780010835 (8)pir|B86299|B862995e-62hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops
JMSF034N22Sequence628005024 (8)pir|B86299|B862992e-60hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops653010835 (8)pir|B86299|B862998e-55hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops
JMSF035N22Sequence181010835 (8)pir|B86299|B862992e-11hypothetical protein F3O9.19 - Arabidopsis thaliana>gb:AE005172_890622 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024B07+ TAGACAATTCCGACCACGATCAAGACAGGGAGGGGATGGATTTAT
rJMSF015E10+ ATTNTAGACAATTCCGACCACGATCAAGACAGGGAGGGGATGGATTTAT
rJMSF008L05+ CCACGATCAAGACAGGGAGGGGATGGATTTAT
rJMSF015M16+ GGGATGGATTTAT
                      ____________________________________________________________
consensus ATTNTAGACAATTCCGACCACGATCAAGACAGGGAGGGGATGGATTTAT
 
. : . : . : . : . : . :
rJMSF024B07+ ACGCGGCTCT-AAAGCTGCTGCTAAACAAAGGGTGGGCTTTGCGGCGGCTGTTAACGGTG
rJMSF015E10+ ACGCGGCTCTNAAAGCTGCTGCTAAACAAAGGGTGGGCTTTGCGGCGGCTGTTAACGGTG
rJMSF034N22+ TTGCGGCGGCTGTTAACGGTG
rJMSF008L05+ ACGCGGCTCT-AAAGCTGCTGCTAAACAAAGGGTGGGCTTTGCGGCGGCTGTTAACGGTG
rJMSF015M16+ ACGCGGCTCTAAAAGCTGCTGCTAAACAAAGGGTGGGCTTTGCGGCGGCTGTTAACGGTG
                      ____________________________________________________________
consensus ACGCGGCTCTAAAAGCTGCTGCTAAACAAAGGGTGGGCTTTGCGGCGGCTGTTAACGGTG
 
. : . : . : . : . : . :
rJMSF024B07+ ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
rJMSF015E10+ ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
rJMSF034N22+ ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
rJMSF008L05+ ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
rJMSF015M16+ ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
                      ____________________________________________________________
consensus ATGTTAGTCTCCGTCGGGACAGGGATAGTGTACTACGGAATCCCGTTGGGTGTCGGGGAA
 
. : . : . : . : . : . :
rJMSF024B07+ ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
rJMSF015E10+ ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
rJMSF034N22+ ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
rJMSF008L05+ ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
rJMSF015M16+ ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
                      ____________________________________________________________
consensus ATGCCGTTGAATCTCTACCTCAGCACGACGTTAAACGCCTTGGCGGAGCTGCCGGCGTCG
 
. : . : . : . : . : . :
rJMSF024B07+ CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
rJMSF015E10+ CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
rJMSF034N22+ CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
rJMSF008L05+ CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
rJMSF015M16+ CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
                      ____________________________________________________________
consensus CTGACGACGTTCTTGCTGATAGACAAGCTGAAGCGGCGGAGCTCGGTGGTGGGGTTAGGG
 
. : . : . : . : . : . :
rJMSF024B07+ CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
rJMSF015E10+ CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
rJMSF034N22+ CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
rJMSF008L05+ CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
rJMSF015M16+ CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
                      ____________________________________________________________
consensus CTGCTGAGCGGCGCGTGTTGCGTTGGGTGCGCGGTGTTCGTGAGCGAGGAGTTGAAGTGG
 
. : . : . : . : . : . :
rJMSF024B07+ GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
rJMSF015E10+ GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
rJMSF034N22+ GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
rJMSF035N22+ GGCGTTCAACGTGNTC
rJMSF008L05+ GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
rJMSF015M16+ GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
                      ____________________________________________________________
consensus GTCCAGATCGGGCTGGAAATCGTGGGGTTCTTCAACGCCTGCACGGCGTTCAACGTGCTC
 
. : . : . : . : . : . :
rJMSF024B07+ TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
rJMSF015E10+ TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
rJMSF034N22+ TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
rJMSF035N22+ TTGATANACACGCTGGAGCTCTTCCCGACNTGNGTGAGGAACTCGGNGGTGTCGATAGTG
rJMSF008L05+ TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
rJMSF015M16+ TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
                      ____________________________________________________________
consensus TTGATATACACGCTGGAGCTCTTCCCGACCTGCGTGAGGAACTCGGCGGTGTCGATAGTG
 
. : . : . : . : . : . :
rJMSF024B07+ AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCTGGTGGCGCTGGGGAGAACC
rJMSF015E10+ AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCCGGTGGCGCTGGGGAGAACC
rJMSF034N22+ AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCTGGTGGCGCTGGGGAGAACC
rJMSF035N22+ AGGCAAGNCATGATGCTCGNCGNCNCCATCAGCCCGCTGCTGNTGGCGCTGGGGAGAACC
rJMSF008L05+ AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCTGGTGGCGCTGGGGAGAACC
rJMSF015M16+ AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCTGGTGGCGCTGGGGAGAACC
                      ____________________________________________________________
consensus AGGCAAGCCATGATGCTCGGCGGCGCCATCAGCCCGCTGCTGGTGGCGCTGGGGAGAACC
 
. : . : . : . : . : . :
rJMSF024B07+ AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
rJMSF015E10+ AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
rJMSF034N22+ AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
rJMSF035N22+ AACAGGTTNTNNTCCTACGGNGTTTTCGGACTCNCAATCGG
rJMSF008L05+ AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
rJMSF015M16+ AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
                      ____________________________________________________________
consensus AACAGGTTTTACTCCTACGGGGTTTTCGGACTCGCAATCGGTGTGTGTTGCTTGTTTGTG
 
. : . : . : . : . : . :
rJMSF024B07+ ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
rJMSF015E10+ ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
rJMSF034N22+ ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
rJMSF008L05+ ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
rJMSF015M16+ ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
                      ____________________________________________________________
consensus ATTTGCTTGCCGGAGACAATGGGGGGAGAAATCTGCGACACAATTGACGAGGAGGAGAGC
 
. : . : . : . : . : . :
rJMSF024B07+ AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
rJMSF015E10+ AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
rJMSF034N22+ AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
rJMSF008L05+ AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
rJMSF015M16+ AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
                      ____________________________________________________________
consensus AAGGGGAACGGAATAAGCAATGTTTGAAATAATACGGTGGCCGCCGCCGCCGCCGTAAAG
 
. : . : . : . : . : . :
rJMSF024B07+ TGTACCGTTTGTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTA-CCGTGAT
rJMSF015E10+ TGTACCGTTTGTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTA-CCGTGAT
rJMSF034N22+ TGTACCGTTTGTCACTCT
rJMSF008L05+ TGTACCGTTTGTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTA-CCGTGAT
rJMSF015M16+ TGTACCGTTTGTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTA-CCGTGAT
rJMFF040O04+ GTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTACCCGTGAT
                      ____________________________________________________________
consensus TGTACCGTTTGTCACTCTTGCTTTGCATGCACACAGTAATTAAATTTAATTA-CCGTGAT
 
. : . : . : . : . : . :
rJMSF024B07+ GGG-CCCATGGCACTAT
rJMSF015E10+ GGG-CCCATGGCACTATTGTACTTAATACT
rJMSF008L05+ GGG-CCCATGGCACTATTGTACTTAATACT
rJMSF015M16+ GGG-CCCATGGCACTATTGTACTTAATACT
rJMFF040O04+ GGGCCCCATGGCACTATTGTACTTAATACTTATCTTCCCCAATTGTTTGTGATAGGAAAT
                      ____________________________________________________________
consensus GGG-CCCATGGCACTATTGTACTTAATACTTATCTTCCCCAATTGTTTGTGATAGGAAAT
 
. : . : . : . : . : . :
rJMFF040O04+ ATACTTTGGTCTACAACTCATCTTATCCCCTGGACCTGGTTGGATAGGTCATTTCCTGAT
                      ____________________________________________________________
consensus ATACTTTGGTCTACAACTCATCTTATCCCCTGGACCTGGTTGGATAGGTCATTTCCTGAT
 
. : . : . : . : . : . :
rJMFF040O04+ CTGAACCGATTAGAGTGTAGCGCCTGGCTGACTCGACTTGAAAGATTATCGACTATGTAG
                      ____________________________________________________________
consensus CTGAACCGATTAGAGTGTAGCGCCTGGCTGACTCGACTTGAAAGATTATCGACTATGTAG
 
. : . : . : . : . : . :
rJMFF040O04+ CTTGATGAGCCGAACTGTTACCTTAATCTTTCTTTTCGGTACCGACCTGTTTCTTCGTTC
                      ____________________________________________________________
consensus CTTGATGAGCCGAACTGTTACCTTAATCTTTCTTTTCGGTACCGACCTGTTTCTTCGTTC
 
. : . : . : . : . : . :
rJMFF040O04+ GAGACCCCAGGCACGTATACTTAGCGTCTAAGTTCATCCCAATACGCAATTGGTTAGTCA
                      ____________________________________________________________
consensus GAGACCCCAGGCACGTATACTTAGCGTCTAAGTTCATCCCAATACGCAATTGGTTAGTCA
 
. : . : . : . : . : . :
rJMFF040O04+ GATATACTTTTACACGTGCACTTTTCTCCTCAGCCGACCAGATTACCCAGTGCATGGAGG
rJMFF048K13+ GCATGGAGG
                      ____________________________________________________________
consensus GATATACTTTTACACGTGCACTTTTCTCCTCAGCCGACCAGATTACCCAGTGCATGGAGG
 
. : . : . : . : . : . :
rJMFF040O04+ GTACGTGGCGCACATGCCGGTCCGTCAACAAGTGTCCCCTCAAATTCTCTATAAATACCC
rJMFF048K13+ GTACGTGGCGCACATGCCGGTCCGTCAACAAGTGTCCCCTCAAATTTTCTATAAATACCC
                      ____________________________________________________________
consensus GTACGTGGCGCACATGCCGGTCCGTCAACAAGTGTCCCCTCAAATTTTCTATAAATACCC
 
. : . : . : . : . : . :
rJMFF040O04+ CGCGAGACGCGGGTAAAAGAGACTTTTTTGGCAACTTCTTAATAGCCCATCCACCTTAGC
rJMFF048K13+ CGCGAGACGCGGGTAAAAGAGACTTTTTTGGCAACTTCTTAATAGCCCATCCCCCTTAGC
                      ____________________________________________________________
consensus CGCGAGACGCGGGTAAAAGAGACTTTTTTGGCAACTTCTTAATAGCCCATCCCCCTTAGC
 
. : . : . : . : . : . :
rJMFF040O04+ TCGGGAACCTCTGGCCTCACGCCATTAGTCGAGCATAGTACCTTAAACCAATAAGCAGAC
rJMFF048K13+ TCGGGAACCTCTGGCCTCACGCCATTAGTCGAGCATAGTACCTTAAACCAATAAGCAGAC
                      ____________________________________________________________
consensus TCGGGAACCTCTGGCCTCACGCCATTAGTCGAGCATAGTACCTTAAACCAATAAGCAGAC
 
. : . : . : . : . : . :
rJMFF040O04+ CGCATAAGGGCCGAACCCGCTCCAATCCTGTCTTTTGTACATATTCGTAGTAGACGCGGT
rJMFF048K13+ CGCATAAGGGCCGAACCCGCTCCAATCCTGTCTTTTGTACATATTCGTAGTAGACGCGGT
                      ____________________________________________________________
consensus CGCATAAGGGCCGAACCCGCTCCAATCCTGTCTTTTGTACATATTCGTAGTAGACGCGGT
 
. : . : . : . : . : . :
rJMFF040O04+ ATTTACTACATCAGTTTGGATGGTCCTATCTACTATTCTTCATTCAATCATTCCTCAGAT
rJMFF048K13+ ATTTACTACATCAGTTTGGATGGTCCTATCTACTATTCTTCATTCAATCATTCCTCAGAT
                      ____________________________________________________________
consensus ATTTACTACATCAGTTTGGATGGTCCTATCTACTATTCTTCATTCAATCATTCCTCAGAT
 
. : . : . : . : . : . :
rJMFF040O04+ CTTATAGGAAAATACTATGTGTACTCTTAT
rJMFF048K13+ TTTATAGGAAAATACTATGTGTACTCTTATTTTTTACTGTTAACTTTTACTCTCATCCAT
                      ____________________________________________________________
consensus TTTATAGGAAAATACTATGTGTACTCTTATTTTTTACTGTTAACTTTTACTCTCATCCAT