Previous Contig 010834:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O01Sequence568000229 (5)gb:AC130604_17408166e-50Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq716010834 (5)
JMFF009N23Sequence574000229 (5)gb:AC130604_17408161e-57Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq771010834 (5)
JMFF047C14Sequence421000229 (5)gb:AC130604_17408162e-35Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq373010834 (5)
JMFF048K10Sequence428000229 (5)gb:AC130604_17408167e-34Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq410010834 (5)
JMSF048I23Sequence697000229 (5)gb:AC130604_17408162e-74Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq711010834 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048I23+ CCCGTCA
rJMFF004O01+ CCCGTCA
rJMFF009N23+ CATGGAGAGAAGTTCGTCTGTTAGAGGTAGTTATACTTCTTTATCCCCGTCA
                      ____________________________________________________________
consensus CATGGAGAGAAGTTCGTCTGTTAGAGGTAGTTATACTTCTTTATCCCCGTCA
 
. : . : . : . : . : . :
rJMSF048I23+ TTGTTGGCCCAACTATGTAGTGCAAATGGGGAACCATCGAAACATGAAGACGAGGGTAGT
rJMFF004O01+ TTGTTGGCCCAACTATGTAGTGCAAATGGGGAACCATCGAAACATGAAGACGAGGGTAGT
rJMFF009N23+ TTGTTGGCCCAACTATGTAGTGCAAATGGGGAACCATCGAAACATGAAGACGAGGGTAGT
                      ____________________________________________________________
consensus TTGTTGGCCCAACTATGTAGTGCAAATGGGGAACCATCGAAACATGAAGACGAGGGTAGT
 
. : . : . : . : . : . :
rJMSF048I23+ GAGGCATGATTCAGCCCAGTGGAAGTCGCCTCAAGAAGACGAGAGCTTTACACATGACAT
rJMFF004O01+ GAGGCATGATTCAGCCCAGTGGAAGTCGCCTCAAGAAGACGAGAGCTTTACACATGACAT
rJMFF009N23+ GAGGCATGATTCAGCCCAGTGGAAGTCGCCTCAAGAAGACGAGAGCTTTACACATGACAT
                      ____________________________________________________________
consensus GAGGCATGATTCAGCCCAGTGGAAGTCGCCTCAAGAAGACGAGAGCTTTACACATGACAT
 
. : . : . : . : . : . :
rJMSF048I23+ AATCACCCGAAAGCTAGCCTATTTGATTAAGACTTTTTTGTTAGCAAAGGAGTTATCTCT
rJMFF004O01+ AATCACCCGAAAGCTAGCCTATTTGATTAAGACTTTTTTGTTAGCAAAGGAGTTATCTCT
rJMFF009N23+ AATCACCCGAAAGCTAGCCTATTTGATTAAGACTTTTTTGTTAGCAAAGGAGTTATCTCT
                      ____________________________________________________________
consensus AATCACCCGAAAGCTAGCCTATTTGATTAAGACTTTTTTGTTAGCAAAGGAGTTATCTCT
 
. : . : . : . : . : . :
rJMSF048I23+ CGAGATTATTTTGTACGCGATAAGGCAATAATGTGACTTCTTGGAAGGTGTTTCTGAAGC
rJMFF004O01+ CGAGATTATTTTGTACGCGATAAGGCAATAATGTGACTTCTTGGAAGGTGTTTCTGAAGC
rJMFF009N23+ CGAGATTATTTTGTACGCGATAAGGCAATAATGTGACTTCTTGGAAGGTGTTTCTGAAGC
                      ____________________________________________________________
consensus CGAGATTATTTTGTACGCGATAAGGCAATAATGTGACTTCTTGGAAGGTGTTTCTGAAGC
 
. : . : . : . : . : . :
rJMSF048I23+ ATTCGTGTTTCACAACTATGGTTCAGCCGCCTGTTTGTGGCTTCACCTTTGCGTTCTGAA
rJMFF004O01+ ATTCGTGTTTCACAACTATGGTTCAGCCGCCTGTTTGTGGCTTCACCTTTGCGTTCTGAA
rJMFF009N23+ ATTCGTGTTTCACAACTATGGTTCAGCCGCCTGTTTGTGGCTTCACCTTTGCGTTCTGAA
                      ____________________________________________________________
consensus ATTCGTGTTTCACAACTATGGTTCAGCCGCCTGTTTGTGGCTTCACCTTTGCGTTCTGAA
 
. : . : . : . : . : . :
rJMSF048I23+ TGGTCAAAAAATCGGAAGAAATTCATCGGGTAGCTGCTTCAACTTGGCATGTACAGTTTT
rJMFF004O01+ TGGTCAAAAAATCGGAAGAAATTCATCGGGTAGCTGCTTCAACTTGGCATGTACAGTTTT
rJMFF009N23+ TGGTCAAAAAATCGGAAGAAATTCATCGGGTAGCTGCTTCAACTTGGCATGTACAGTTTT
                      ____________________________________________________________
consensus TGGTCAAAAAATCGGAAGAAATTCATCGGGTAGCTGCTTCAACTTGGCATGTACAGTTTT
 
. : . : . : . : . : . :
rJMSF048I23+ TCCGTGTTCTAGGCATGATATATACAGTGTGGAATTAGATACATATTCCGATATTCGTTC
rJMFF004O01+ TCCGTGTTCTAGGCATGATATATACAGTGTGGAATTAGATACATATTCCGATATTCGTTC
rJMFF009N23+ TCCGTGTTCTAGGCATGATATATACAGTGTGGAATTAGATACATATTCCGATATTCGTTC
rJMFF047C14+ ATTAGATACATATTCCGATATTCGTTC
rJMFF048K10+ AGGCATGATATATACAGTGTGGAATTAGATACATATTCCGATATTCGTTC
                      ____________________________________________________________
consensus TCCGTGTTCTAGGCATGATATATACAGTGTGGAATTAGATACATATTCCGATATTCGTTC
 
. : . : . : . : . : . :
rJMSF048I23+ AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
rJMFF004O01+ AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
rJMFF009N23+ AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
rJMFF047C14+ AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
rJMFF048K10+ AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
                      ____________________________________________________________
consensus AATATCTTGTGATTATATTTTGGAGAAAGGGATTACAAAGATCTGAGCTGAAGCATACAT
 
. : . : . : . : . : . :
rJMSF048I23+ GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
rJMFF004O01+ GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
rJMFF009N23+ GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
rJMFF047C14+ GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
rJMFF048K10+ GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
                      ____________________________________________________________
consensus GTTGCTGCATGGCCAAATTTATAGAGGTTGGAAGTTCATTCATTGAATGGCTTATGGCCA
 
. : . : . : . : . : . :
rJMSF048I23+ TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
rJMFF004O01+ TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
rJMFF009N23+ TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
rJMFF047C14+ TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
rJMFF048K10+ TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
                      ____________________________________________________________
consensus TGAAAATAAAGTGCAGTATCCATTGTTATCGTTGCTGGATTTATCCCTTTGTCTGGGGTG
 
. : . : . : . : . : . :
rJMSF048I23+ TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
rJMFF004O01+ TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
rJMFF009N23+ TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
rJMFF047C14+ TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
rJMFF048K10+ TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
                      ____________________________________________________________
consensus TGGTTCAGGAAACTGGTTGGTACAATTTGTTGTATAGTTAAAGTATATAGAATTTATCTG
 
. : . : . : . : . : . :
rJMSF048I23+ TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAAT
rJMFF004O01+ TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAATTGAAACATTA
rJMFF009N23+ TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAATTGAAACATTATACTTCAATT
rJMFF047C14+ TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAATTGAAACATTATACTTCAATTT
rJMFF048K10+ TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAATTGAAACATTATACTTCAATTT
                      ____________________________________________________________
consensus TTTATAGATTTGCTGCTTGTGTGTTTTGTACATGCTAATTGAAACATTATACTTCAATTT
 
. : . : . : . : . : . :
rJMFF047C14+ TCATATAGAACATTTACATAAAAAAAAAAAAAAAACTCTCCAGGGT
rJMFF048K10+ TCATATAGAACATTTACATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TCATATAGAACATTTACATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG