Previous Contig 010833:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014E19Sequence715010833 (2)gb:AB007646_15101674e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MGI19.
JMFF048J23Sequence371002070 (14)pir|T07391|T073915e-30probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t332010833 (2)gb:AJ606313_18119591e-18Lycopersicon esculentum mRNA for alpha glucosidase II (gluII gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014E19+ GTCCA
                      ____________________________________________________________
consensus GTCCA
 
. : . : . : . : . : . :
rJMFF014E19+ AGGAATTTACACTGAGAGAGCTAAGCATGTATCTGTGTATCTTCCTGGGGACCAATCTTG
                      ____________________________________________________________
consensus AGGAATTTACACTGAGAGAGCTAAGCATGTATCTGTGTATCTTCCTGGGGACCAATCTTG
 
. : . : . : . : . : . :
rJMFF014E19+ GTATGATCTTAGAAGTGGAACTGCATATAAAGGGGGTCTGACACACAAACTCGAGGCTTT
                      ____________________________________________________________
consensus GTATGATCTTAGAAGTGGAACTGCATATAAAGGGGGTCTGACACACAAACTCGAGGCTTT
 
. : . : . : . : . : . :
rJMFF014E19+ GGAAGAGAGTATACCAGCTTTCCAAAGGGCTGGAACCATCATACCAAGAAAAGATCGCTT
                      ____________________________________________________________
consensus GGAAGAGAGTATACCAGCTTTCCAAAGGGCTGGAACCATCATACCAAGAAAAGATCGCTT
 
. : . : . : . : . : . :
rJMFF014E19+ TCGTAGAAGCTCTACACAGATGGAGAATGACCCTTACACCCTGGTTATTGCTCTTAATAG
                      ____________________________________________________________
consensus TCGTAGAAGCTCTACACAGATGGAGAATGACCCTTACACCCTGGTTATTGCTCTTAATAG
 
. : . : . : . : . : . :
rJMFF014E19+ TTCCCAGGCTGCTGAAGGCGAGCTCTATATCGACGATGGGAGGAGCTTCGATTTCAAACA
                      ____________________________________________________________
consensus TTCCCAGGCTGCTGAAGGCGAGCTCTATATCGACGATGGGAGGAGCTTCGATTTCAAACA
 
. : . : . : . : . : . :
rJMFF014E19+ AGGAGCCTACATCCATCGCCGCTTCATATTCTCCGCTGGAACTCTCACATCCTTGAACCT
                      ____________________________________________________________
consensus AGGAGCCTACATCCATCGCCGCTTCATATTCTCCGCTGGAACTCTCACATCCTTGAACCT
 
. : . : . : . : . : . :
rJMFF014E19+ GAAACCATCTTCTGGGAGTAAGAAATTTTCATCAGATTGCACAGTGGAGAGGATAATTCT
rJMFF048J23+ TCATCAGATTGCACAGTGGAGAGGATAATTCT
                      ____________________________________________________________
consensus GAAACCATCTTCTGGGAGTAAGAAATTTTCATCAGATTGCACAGTGGAGAGGATAATTCT
 
. : . : . : . : . : . :
rJMFF014E19+ GTTGGGATTATCTGAGGGACCAAAGTCTGCCCTGGTCGAGCCGGGGAACAACAAAGTGGA
rJMFF048J23+ GTTGGGATTATCTGAGGGACCAAAGTCTGCCCTGGTCGAGCCGGGGAACAACAAAGTGGA
                      ____________________________________________________________
consensus GTTGGGATTATCTGAGGGACCAAAGTCTGCCCTGGTCGAGCCGGGGAACAACAAAGTGGA
 
. : . : . : . : . : . :
rJMFF014E19+ GGTCGAAAAAGGGCCGCTGCTTCTCCGAGAGAGCCAAGGGCCGTCTGTGCTAACTATACG
rJMFF048J23+ GGTCGAAAAAGGGCCGCTGCTTCTCCGAGAGAGCCAAGGGCCGTCTGTGCTAACTATACG
                      ____________________________________________________________
consensus GGTCGAAAAAGGGCCGCTGCTTCTCCGAGAGAGCCAAGGGCCGTCTGTGCTAACTATACG
 
. : . : . : . : . : . :
rJMFF014E19+ GAAGCCAAATGTGCGAGTAGGCGATGATTGGTCGATAAAGATTTTGTAAGAATTGGCTGA
rJMFF048J23+ GAAGCCAAATGTGCGAGTAGGCGATGATTGGTCGATAAAGATTTTGTAAGAATTGGCTGA
                      ____________________________________________________________
consensus GAAGCCAAATGTGCGAGTAGGCGATGATTGGTCGATAAAGATTTTGTAAGAATTGGCTGA
 
. : . : . : . : . : . :
rJMFF014E19+ TTTAACATGCAGCAGCTGGATAATTAATTTTACACTTGGGTGAAGAACTGATGTAATTGG
rJMFF048J23+ TTTAACATGCAGCAGCTGGATAATTAATTTTACACTTGGGTGAAGAACTGATGTAATTGG
                      ____________________________________________________________
consensus TTTAACATGCAGCAGCTGGATAATTAATTTTACACTTGGGTGAAGAACTGATGTAATTGG
 
. : . : . : . : . : . :
rJMFF014E19+ TGATGGTAGGAATGCGACGTTGAGAAATGCTTATTAATAATAGGAAGGAA
rJMFF048J23+ TGATGGTAGGAATGCGACGTTGAGAAATGCTTATTAATAATAGGAAGGAATTTTAAATAG
                      ____________________________________________________________
consensus TGATGGTAGGAATGCGACGTTGAGAAATGCTTATTAATAATAGGAAGGAATTTTAAATAG