Previous Contig 010832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002F20Sequence603000294 (31)sp|P20363|TBA3_ARATH1e-90Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido757010832 (36)gb:AB096718_15258273e-86Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF006A14Sequence532000294 (31)sp|P20363|TBA3_ARATH4e-72Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido745010832 (36)gb:AB096718_15258271e-79Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF006A22Sequence508000294 (31)sp|P20363|TBA3_ARATH9e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido752010832 (36)gb:AB096718_15258275e-86Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF008O15Sequence630000294 (31)sp|P20363|TBA3_ARATH9e-88Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido757010832 (36)gb:AY542972_13344281e-78Bigelowiella natans alpha tubulin 2 mRNA, complete cds.
JMFF009A16Sequence506000294 (31)sp|P20363|TBA3_ARATH9e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido735010832 (36)gb:AB096718_15258272e-94Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF010F23Sequence786010832 (36)gb:AB096718_15258272e-93Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF011I08Sequence501000294 (31)sp|P11237|TBA1_NAEGR1e-63Tubulin alpha-1/2/3 chain.>pir|A28914|A28914 tubulin alpha chain - Naegleria gru758010832 (36)gb:AB096718_15258273e-79Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF018H16Sequence507000294 (31)sp|P20363|TBA3_ARATH9e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido734010832 (36)gb:AB096718_15258272e-94Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF020L06Sequence510000294 (31)sp|P20363|TBA3_ARATH3e-74Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido657010832 (36)gb:AB096718_15258275e-68Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF022J21Sequence504000294 (31)sp|P20363|TBA3_ARATH3e-76Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido788010832 (36)gb:AB096718_15258272e-92Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF023A08Sequence480000294 (31)sp|P20363|TBA3_ARATH2e-71Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido737010832 (36)gb:AB096718_15258272e-94Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF024A16Sequence630010832 (36)gb:AB096718_15258272e-76Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF026N08Sequence582000294 (31)sp|P20363|TBA3_ARATH2e-84Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido779010832 (36)gb:AB096718_15258273e-90Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF028P08Sequence573010832 (36)gb:AB096718_15258273e-58Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.647010832 (36)gb:AB096718_15258271e-56Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF030F16Sequence520000294 (31)sp|P20363|TBA3_ARATH3e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido689010832 (36)gb:AB096718_15258271e-74Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF030J21Sequence478000294 (31)sp|P20363|TBA3_ARATH2e-71Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido715010832 (36)gb:AB096718_15258276e-94Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF032B23Sequence506000294 (31)sp|P20363|TBA3_ARATH9e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido779010832 (36)gb:AB096718_15258271e-90Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF033K04Sequence505000294 (31)sp|P20363|TBA3_ARATH1e-75Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido783010832 (36)gb:AB096718_15258277e-94Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF035F23Sequence466000294 (31)sp|P20363|TBA3_ARATH7e-77Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido761010832 (36)gb:AB096718_15258279e-83Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF035K15Sequence588000294 (31)sp|P20363|TBA3_ARATH3e-88Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido715010832 (36)gb:AB096718_15258276e-75Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF042B13Sequence627000294 (31)sp|P20363|TBA3_ARATH3e-88Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido642010832 (36)gb:AB096718_15258279e-75Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF042E02Sequence659000294 (31)sp|P20363|TBA3_ARATH2e-94Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido589010832 (36)gb:AB096718_15258274e-49Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF042E19Sequence648000294 (31)sp|P20363|TBA3_ARATH2e-92Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido608010832 (36)gb:AB096718_15258272e-52Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF043K15Sequence633000294 (31)sp|P20363|TBA3_ARATH4e-89Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido638010832 (36)gb:AB096718_15258275e-68Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF045A22Sequence633000294 (31)sp|P20363|TBA3_ARATH1e-85Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido611010832 (36)gb:AB096718_15258271e-55Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMFF048J22Sequence468000294 (31)sp|P20363|TBA3_ARATH2e-65Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido448010832 (36)gb:AF182309_17749483e-12Euglena gracilis alpha-tubulin mRNA, complete cds.>gb:AF182553_1774970 Euglena g
JMFN009F06Sequence606010832 (36)gb:MSI437638_1687126e-106Miscanthus sinensis macronuclear TUA6 gene for alpha-tubulin, variety glaber.
JMFN034K02Sequence607010832 (36)gb:MSI437638_1687126e-106Miscanthus sinensis macronuclear TUA6 gene for alpha-tubulin, variety glaber.
JMFN043N18Sequence485010832 (36)gb:AY229882_15913263e-27Populus tremuloides alpha-tubulin 2 mRNA, partial cds.
JMSF014G09Sequence531000294 (31)sp|P20363|TBA3_ARATH1e-81Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido767010832 (36)gb:AB096718_15258273e-90Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMSF018K20Sequence481010832 (36)gb:AB096718_15258273e-45Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.562010832 (36)gb:AB096718_15258274e-45Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMSF030E11Sequence501006654 (4)gb:AC025815_15396102e-06Arabidopsis thaliana chromosome 1 BAC T8D8 genomic sequence, complete sequence.617010832 (36)gb:AB096718_15258272e-68Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMSF031J04Sequence630000294 (31)sp|P20363|TBA3_ARATH1e-88Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido786010832 (36)gb:AB096718_15258272e-92Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.
JMSF042N04Sequence732000294 (31)sp|P20363|TBA3_ARATHe-109Tubulin alpha-3/alpha-5 chain.>pir|A32712|A32712 tubulin alpha-5 chain - Arabido659010832 (36)gb:AB096718_15258273e-75Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034K02- CATCTGTAGGAGGTCCCTAGATGTTGAGAGGCCAACCTATACTAATTTGAACAGGCTAA
JMFN009F06- ATCTGTAGGAGGTCCCTAGATGTTGAGAGGCCAACCTATACTAATTTGAACAGGCTAA
                      ____________________________________________________________
consensus CATCTGTAGGAGGTCCCTAGATGTTGAGAGGCCAACCTATACTAATTTGAACAGGCTAA
 
. : . : . : . : . : . :
JMFN034K02- TTTCTCAAATCATATCATCCCTGACCACCTCATTAAGGTTTGATGGAGCCATAAATGTGG
JMFN009F06- TTTCTCAAATCATATCATCCCTGACCACCTCATTAAGGTTTGATGGAGCCATAAATGTGG
                      ____________________________________________________________
consensus TTTCTCAAATCATATCATCCCTGACCACCTCATTAAGGTTTGATGGAGCCATAAATGTGG
 
. : . : . : . : . : . :
JMFN034K02- ACATGACAGAGTTCCAAACCAACCTTGTACCCTATCCCCGTATACATTTCATGCTTTCTT
JMFN009F06- ACATGACAGAGTTCCAAACCAACCTTGTACCCTATCCCCGTATACATTTCATGCTTTCTT
rJMFF023A08+ GTATACATTTCATGCTTTCTT
rJMFF009A16+ CGTATACATTTCATGCTTTCTT
rJMFF018H16+ CCGTATACATTTCATGCTTTCTT
rJMFF030J21+ GTATACATTTCATGCTTTCTT
rJMSF031J04+ CCGTATACA-TTCATGCTTTCTT
rJMFF033K04+ GTATACATTTCATGCTTTCTT
rJMSF014G09+ CTT
rJMFF010F23+ CATTTCATGCTTTCTT
rJMFF032B23+ TTCTT
rJMFF026N08+ TTCTT
rJMFF022J21+ TTCATGCTTTCTT
                      ____________________________________________________________
consensus ACATGACAGAGTTCCAAACCAACCTTGTACCCTATCCCCGTATACATTTCATGCTTTCTT
 
. : . : . : . : . : . :
JMFN034K02- CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
JMFN009F06- CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF023A08+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF009A16+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF018H16+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF030J21+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMSF031J04+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF033K04+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMSF014G09+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF010F23+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF032B23+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF026N08+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF002F20+ TCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF011I08+ TCAGCTGCCAA-GGCATACCCATGAGCAGCTTTCTGTCCCGGG
rJMFF006A14+ CAGCTGCCAAGGGCATA-CCATGAGCAGCTTTCTGTCCCCGG
rJMFF035F23+ ATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGTCCCCGG
rJMFF008O15+ CAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF006A22+ TGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
rJMFF022J21+ CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
                      ____________________________________________________________
consensus CATATGCTCCTGTGATCTCAGCTGCCAA-GGCATA-CCATGAGCAGCTTTCTGT-CCCGG
 
. : . : . : . : . : . :
JMFN034K02- AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
JMFN009F06- AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF023A08+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF024A16+ TTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF042B13+ AGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF009A16+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF018H16+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF030J21+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMSF031J04+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF033K04+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMSF014G09+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMSF042N04+ TCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF010F23+ AGATTACAAGTGCTGTCTTTGAGCCNTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF032B23+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF030F16+ CCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF026N08+ AGATTACAAGTGCTGTCTTTGAGCCNTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF002F20+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF011I08+ AGATTNCAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF006A14+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF035F23+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF008O15+ AGATTACAAGTGCTGTCTTTGAGCCNTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
rJMFF006A22+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAGTGTGA-CCCCAGGCAC
rJMFF035K15+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGACCCCCAGGCAC
rJMFF022J21+ AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
                      ____________________________________________________________
consensus AGATTACAAGTGCTGTCTTTGAGCCCTCAAGCATGATGGCAAAATGTGA-CCCCAGGCAC
 
. : . : . : . : . : . :
JMFN034K02- GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
JMFN009F06- GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF023A08+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF024A16+ GGGAAATACATGGCTTGCTGCTTGATGTNCCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF042B13+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF009A16+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF018H16+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF030J21+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMSF031J04+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF033K04+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMSF014G09+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMSF042N04+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMSF030E11+ GCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF043K15+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
JMFF028P08- TTCCTAAGGATGTCAAT
rJMFF010F23+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF032B23+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF030F16+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF026N08+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF002F20+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF020L06+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF011I08+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF006A14+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF035F23+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF008O15+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF006A22+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF035K15+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF022J21+ GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
rJMFF045A22+ TCAAT
rJMFF028P08+ GGATGTCAAT
                      ____________________________________________________________
consensus GGGAAATACATGGCTTGCTGCTTGATGTACCGAGGGGATGTTGTTCCTAAGGATGTCAAT
 
. : . : . : . : . : . :
JMFN034K02- GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
JMFN009F06- GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF023A08+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF024A16+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF042B13+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF009A16+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF018H16+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF030J21+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMSF031J04+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF033K04+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMSF014G09+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMSF042N04+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMSF030E11+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF043K15+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
JMFF028P08- GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMSF018K20+ GGTGCCCAACC
JMSF018K20- GGTGCCCAACC
rJMFF010F23+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF032B23+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF030F16+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF026N08+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF002F20+ GCTGCTTTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF020L06+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF011I08+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF006A14+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF035F23+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF008O15+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF006A22+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF035K15+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF022J21+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF045A22+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF028P08+ GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF042E02+ CAGTTCAGTTTGTTGACTGGTGCCCAACC
rJMFF042E19+ TATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
                      ____________________________________________________________
consensus GCTGCTGTTGCCACTATCAAAACGAAACGCACAGTTCAGTTTGTTGACTGGTGCCCAACC
 
. : . : . : . : . : . :
JMFN034K02- GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
JMFN009F06- GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF023A08+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF024A16+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF042B13+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF009A16+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF018H16+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF030J21+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMSF031J04+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF033K04+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMSF014G09+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMSF042N04+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMSF030E11+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF043K15+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
JMFF028P08- GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMSF018K20+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
JMSF018K20- GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF010F23+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF032B23+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF030F16+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF026N08+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF002F20+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF020L06+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF011I08+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF006A14+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF035F23+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF008O15+ GGCTTCAAATGTGGGATTAACTACCAACCCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF006A22+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF035K15+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF022J21+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF045A22+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF028P08+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF042E02+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
rJMFF042E19+ GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
                      ____________________________________________________________
consensus GGCTTCAAATGTGGGATTAACTACCAA-CCCCCAACAGTTGTGCCCGGGGGTGATCTTGC
 
. : . : . : . : . : . :
JMFN034K02- CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
JMFN009F06- CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF023A08+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF024A16+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF042B13+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF009A16+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF018H16+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF030J21+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMSF031J04+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF033K04+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMSF014G09+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMSF042N04+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMSF030E11+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF043K15+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
JMFF028P08- CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMSF018K20+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
JMSF018K20- CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF010F23+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF032B23+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF030F16+ CGAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF026N08+ CGAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF002F20+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF020L06+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF011I08+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF006A14+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF035F23+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF008O15+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF006A22+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF035K15+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF022J21+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF045A22+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF028P08+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
JMFN043N18- CTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF042E02+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
rJMFF042E19+ CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
                      ____________________________________________________________
consensus CAAGGTGCAGAGAGCTGTTTGTATGATCAGCAACAACACTGCTGTGGCCGAGGTGTTCTC
 
. : . : . : . : . : . :
JMFN034K02- ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
JMFN009F06- ACGCATTGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF023A08+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF024A16+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF042B13+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF009A16+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF018H16+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF030J21+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMSF031J04+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF033K04+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMSF014G09+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMSF042N04+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMSF030E11+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF043K15+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
JMFF028P08- ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMSF018K20+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
JMSF018K20- ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF010F23+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF032B23+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF030F16+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF026N08+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF002F20+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF020L06+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF011I08+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF006A14+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF035F23+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF008O15+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF006A22+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF035K15+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF022J21+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF045A22+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF028P08+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
JMFN043N18- ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF042E02+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF042E19+ ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
rJMFF048J22+ TTCCAAGAGGGCGTTCGTTCACTGGTATGT
                      ____________________________________________________________
consensus ACGCATCGACCACAAGTTTGATCTCATGTATTCCAAGAGGGCGTTCGTTCACTGGTATGT
 
. : . : . : . : . : . :
JMFN034K02- AGGTGAAGGCATG
JMFN009F06- AGGTGAAGGCATG
rJMFF023A08+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF024A16+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF042B13+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF009A16+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF018H16+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF030J21+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMSF031J04+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF033K04+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMSF014G09+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMSF042N04+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMSF030E11+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF043K15+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
JMFF028P08- AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMSF018K20+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
JMSF018K20- AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF010F23+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF032B23+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF030F16+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF026N08+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF002F20+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF020L06+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF011I08+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF006A14+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF035F23+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF008O15+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF006A22+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF035K15+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF022J21+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF045A22+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF028P08+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
JMFN043N18- AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF042E02+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF042E19+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
rJMFF048J22+ AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
                      ____________________________________________________________
consensus AGGTGAAGGCATGGAAGAAGGAGAATTTTCTGAAGCCCGTGAGGATCTAGCTGCCCTCGA
 
. : . : . : . : . : . :
rJMFF023A08+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF024A16+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF042B13+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF009A16+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF018H16+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF030J21+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMSF031J04+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF033K04+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMSF014G09+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMSF042N04+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMSF030E11+ GAAAGATTACGAAGAAGTTGGTGCT-AAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF043K15+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
JMFF028P08- GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMSF018K20+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
JMSF018K20- GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF010F23+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF032B23+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF030F16+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF026N08+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF002F20+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF020L06+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF011I08+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF006A14+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAATATGATGAAGGAGAAGACTA
rJMFF035F23+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF008O15+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF006A22+ GAAAGATTACGAAGAATTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF035K15+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF022J21+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF045A22+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF028P08+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
JMFN043N18- GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF042E02+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF042E19+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
rJMFF048J22+ GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
                      ____________________________________________________________
consensus GAAAGATTACGAAGAAGTTGGTGCTGAAGGTGTCGAAGAAGATGATGAAGGAGAAGACTA
 
. : . : . : . : . : . :
rJMFF023A08+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF024A16+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF042B13+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF009A16+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF018H16+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF030J21+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMSF031J04+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF033K04+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMSF014G09+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMSF042N04+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMSF030E11+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF043K15+ TTGAAGTGTGGCATCTCGTGTTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
JMFF028P08- TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMSF018K20+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
JMSF018K20- TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF010F23+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF032B23+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF030F16+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF026N08+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF002F20+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF020L06+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF011I08+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF006A14+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF035F23+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF008O15+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF006A22+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF035K15+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF022J21+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF045A22+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF028P08+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
JMFN043N18- TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF042E02+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF042E19+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
rJMFF048J22+ TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
                      ____________________________________________________________
consensus TTGAAGTGTGGCATCTCGT-CTAGGCAGGCTGCTGCCCTGAGCTTCAGCCATTAGCCTGC
 
. : . : . : . : . : . :
rJMFF023A08+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF024A16+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF042B13+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF009A16+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF018H16+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF030J21+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMSF031J04+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF033K04+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMSF014G09+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMSF042N04+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMSF030E11+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF043K15+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
JMFF028P08- TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMSF018K20+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
JMSF018K20- TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF010F23+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF032B23+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF030F16+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF026N08+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF002F20+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF020L06+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF011I08+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF006A14+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF035F23+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF008O15+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF006A22+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF035K15+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF022J21+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF045A22+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF028P08+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
JMFN043N18- TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF042E02+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF042E19+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
rJMFF048J22+ TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
                      ____________________________________________________________
consensus TGCTATATATTCCGTATCTATTTCTTTCTTGGTATATTGTTAAAGTGTTGTTGTGTGTAA
 
. : . : . : . : . : . :
rJMFF023A08+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCT
rJMFF024A16+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAAT
rJMFF042B13+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAA
rJMFF009A16+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTC
rJMFF018H16+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTC
rJMFF030J21+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGT
rJMSF031J04+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF033K04+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMSF014G09+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMSF042N04+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTATNCAGTGTTGCTTCTAATTCAAGTCTT
rJMSF030E11+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF043K15+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
JMFF028P08- AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMSF018K20+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
JMSF018K20- AGCTTTTGGTTGATGTTGAAATCTGTTG
rJMFF010F23+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF032B23+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF030F16+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF026N08+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF002F20+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF020L06+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF011I08+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF006A14+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF035F23+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF008O15+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF006A22+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF035K15+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF022J21+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF045A22+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF028P08+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
JMFN043N18- AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF042E02+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF042E19+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
rJMFF048J22+ AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
                      ____________________________________________________________
consensus AGCTTTTGGTTGATGTTGAAATCTGTTGTTTTAT-CAGTGTTGCTTCTAATTCAAGTCTT
 
. : . : . : . : . : . :
rJMSF031J04+ TAAGAAGTGCCTGCATACCAGTGGTTACCAATTTTCATGTAAACTCAT
rJMFF033K04+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTG
rJMSF014G09+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCA-TTGA
rJMSF042N04+ TAA
rJMSF030E11+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATT
rJMFF043K15+ TAAGAAGTGCCTGCA
JMFF028P08- TAANAAGTGCCTGCATA-CA
rJMSF018K20+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCA-TTGA
rJMFF010F23+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCA-TTGATTAAGCA
rJMFF032B23+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF030F16+ TAAGAAGTGCCTGCATA-CAGTGGTTGCCAATTTTCATGTAAACTCATTTGATTAAGC
rJMFF026N08+ TAAGAAGTGCCTGCATA-CAGTGGTTGCCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF002F20+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF020L06+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF011I08+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF006A14+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATT
rJMFF035F23+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF008O15+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF006A22+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF035K15+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCA-TTGATTAAGCAT
rJMFF022J21+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF045A22+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF028P08+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
JMFN043N18- TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF042E02+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF042E19+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
rJMFF048J22+ TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
                      ____________________________________________________________
consensus TAAGAAGTGCCTGCATA-CAGTGGTTACCAATTTTCATGTAAACTCATTTGATTAAGCAT
 
. : . : . : . : . : . :
rJMFF032B23+ AT
rJMFF026N08+ AT
rJMFF002F20+ AT
rJMFF020L06+ A
rJMFF011I08+ A
rJMFF035F23+ AT
rJMFF008O15+ AT
rJMFF006A22+ AT
rJMFF022J21+ ATT
rJMFF045A22+ ATTTTAGTTT
rJMFF028P08+ ATTTTAGTTT
JMFN043N18- ATTTTAGTTTAATTGGTTTAA
rJMFF042E02+ ATTTTAGTTTAATTGGTTTAA
rJMFF042E19+ ATTTTAGTTTAATTGGTTTAA
rJMFF048J22+ ATTTTAGTTTXXXXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGGTCCGCCATAAGG
                      ____________________________________________________________
consensus ATTTTAGTTTAATTGGTTTAANNNNNNNNNNNNNNCTCTCCAGGGTGGTCCGCCATAAGG