Previous Contig 010814:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004L13Sequence731010814 (7)gb:AF180390_17748212e-83Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMFF048G21Sequence547007709 (7)gb:AF180390_17748214e-60Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.559010814 (7)gb:AF180390_17748213e-24Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMSF010E01Sequence394007709 (7)gb:AF180390_17748211e-28Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.704010814 (7)gb:AF180390_17748214e-71Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMSF020J06Sequence664007709 (7)gb:AF180390_17748214e-83Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.701010814 (7)gb:AF180390_17748211e-69Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMSF022M24Sequence634007709 (7)gb:AF180390_17748212e-78Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.722010814 (7)gb:AF180390_17748211e-87Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMSF040H14Sequence660007709 (7)gb:AF180390_17748216e-68Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.770010814 (7)gb:AF180390_17748216e-84Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.
JMSF046C04Sequence777007709 (7)gb:AF180390_17748212e-78Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.745010814 (7)gb:AF180390_17748211e-86Arabidopsis thaliana non-phototropic hypocotyl 3 (NPH3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022M24+ ANTTTCAAGTCCTGGCTGAG
rJMSF046C04+ CCTGGCTGAG
                      ____________________________________________________________
consensus ANTTTCAAGTCCTGGCTGAG
 
. : . : . : . : . : . :
rJMSF022M24+ GCTTTACCAGAATCAGCAAGAACCTGTGATGATGGCCTCTATAGAGCCATAGACTCCTAT
rJMSF046C04+ GCTTTACCAGAATCAGCAAGAACCTGTGATGATGGCCTCTATAGAGCCATAGACTCCTAT
rJMFF004L13+ TTACCAGAATCAGCAAGAACCTGTGATGATGGCNTNTATAGAGCCATAGACTCCTAT
rJMSF040H14+ TTACCAGAATCAGCAAGAACCTGTGATGATGGCCTCTATAGAGCCATAGACTCCTAT
                      ____________________________________________________________
consensus GCTTTACCAGAATCAGCAAGAACCTGTGATGATGGCCTCTATAGAGCCATAGACTCCTAT
 
. : . : . : . : . : . :
rJMSF022M24+ CTTAAGGCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
rJMSF046C04+ CTTAAGGCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
rJMFF004L13+ CTTAAGGCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
rJMSF020J06+ TCATCCAACGCTCTCAGAACACGAGAGGANGAGGCTATGTCGAGTGATGGAT
rJMSF010E01+ GCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
rJMSF040H14+ CTTAAGGCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
                      ____________________________________________________________
consensus CTTAAGGCTCATCCAACGCTCTCAGAACACGAGAGGAAGAGGCTATGTCGAGTGATGGAT
 
. : . : . : . : . : . :
rJMSF022M24+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
rJMSF046C04+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
rJMFF004L13+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
rJMSF020J06+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
rJMSF010E01+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
rJMSF040H14+ TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
                      ____________________________________________________________
consensus TGCCAGAAGCTCTCGATTGATGCGTGCATGCACGCAGCTCAGAACGAGAGGCTTCCACTC
 
. : . : . : . : . : . :
rJMSF022M24+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
rJMSF046C04+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
rJMFF004L13+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
rJMSF020J06+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
rJMSF010E01+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
rJMSF040H14+ AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
                      ____________________________________________________________
consensus AGAATTGTGGTGCAGGTGCTCTTCTCCGAGCAGGTGAAGATAAGTAACGCCATAGCCAAC
 
. : . : . : . : . : . :
rJMSF022M24+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
rJMSF046C04+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
rJMFF004L13+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
rJMSF020J06+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTNTGCTGTCAAACCGCAAAACC
rJMSF010E01+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
rJMSF040H14+ AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
                      ____________________________________________________________
consensus AGCTCCCTCAAGGATGCCGGGGACTCTCACTATCAGCCTCTGCTGTCAAACCGCAAAACC
 
. : . : . : . : . : . :
rJMSF022M24+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMSF046C04+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMFF004L13+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMSF020J06+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMSF010E01+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMSF040H14+ TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
rJMFF048G21+ ACAGCAGCCAAGAAGGATATC
                      ____________________________________________________________
consensus TTGCTCGAAGCAACGCCACAGTCTTTTCAGGAAGGGTGGACAGCAGCCAAGAAGGATATC
 
. : . : . : . : . : . :
rJMSF022M24+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMSF046C04+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMFF004L13+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMSF020J06+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMSF010E01+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMSF040H14+ AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
rJMFF048G21+ AACACGCTCAAGTNTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
                      ____________________________________________________________
consensus AACACGCTCAAGTTTGAGCTAGAGAACGTCAAGGCCAAGTACGTTCAGCTCCAGAACGAG
 
. : . : . : . : . : . :
rJMSF022M24+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMSF046C04+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMFF004L13+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMSF020J06+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMSF010E01+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMSF040H14+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
rJMFF048G21+ ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
                      ____________________________________________________________
consensus ATGGATATCTTACAGAGGCAATTCGATAAGCTCACAAAACCAAAACAGGCCTCAGCCTGG
 
. : . : . : . : . : . :
rJMSF022M24+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMSF046C04+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMFF004L13+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMSF020J06+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMSF010E01+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMSF040H14+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
rJMFF048G21+ ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
                      ____________________________________________________________
consensus ACTTCAGGATGGAAAAAACTCAGCAAACTCACCAAGATGACACATCTAGACAACCATGAT
 
. : . : . : . : . : . :
rJMSF022M24+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMSF046C04+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMFF004L13+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMSF020J06+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMSF010E01+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMSF040H14+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
rJMFF048G21+ TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
                      ____________________________________________________________
consensus TTGGGGTCTCAAGTTACAAACACAGAAAATACTCGAAAGACGCCTAGAAGGTGGAGAAAT
 
. : . : . : . : . : . :
rJMSF022M24+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMSF046C04+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMFF004L13+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMSF020J06+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMSF010E01+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMSF040H14+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
rJMFF048G21+ TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
                      ____________________________________________________________
consensus TCCATTTCCTAAGTCCCCCCAGCCTTCCCAGTTTCGCCTACTGTTCTATTTTCTGTCCTA
 
. : . : . : . : . : . :
rJMSF022M24+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAAC
rJMSF046C04+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAACCACCTGAGACCATAGCAT
rJMFF004L13+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
rJMSF020J06+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
rJMSF010E01+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
rJMSF040H14+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
rJMFF048G21+ TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
                      ____________________________________________________________
consensus TATTGCAGAAAGATTTCATTTTTTTCCCCGTTATAGAAAAA-CACCTGAGACCATAGCAT
 
. : . : . : . : . : . :
rJMSF046C04+ CAGTT
rJMFF004L13+ CAGTTTATCATCAAT
rJMSF020J06+ CAGTTTATCATCAATTTCATGTTCTTTATA-CAGTTGATTGATTGATCC
rJMSF010E01+ CAGTTTATCATCAATTTCATGTTCTTTATACCAGTTGATTGATTGATCC
rJMSF040H14+ CAGTTTATCATCAATTTCATGTTCTTTATAGCAGTTGATTGATTGATCC
rJMFF048G21+ CAGTTTATCATCAATTTCATGTTCTTTATA-CAGTTGATTGATTGATCCATCTCCCTGTA
                      ____________________________________________________________
consensus CAGTTTATCATCAATTTCATGTTCTTTATA-CAGTTGATTGATTGATCCATCTCCCTGTA
 
. : . : . : . : . : . :
rJMFF048G21+ ATCACTACCTTCATAAATTCATATTTTTAGCTGCATCAACTGAAACCCATATTGTTATCA
                      ____________________________________________________________
consensus ATCACTACCTTCATAAATTCATATTTTTAGCTGCATCAACTGAAACCCATATTGTTATCA
 
. : . : . : . : . : . :
rJMFF048G21+ GCATCAGAACCTATACAATTATGTTAGTCGTCGTAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GCATCAGAACCTATACAATTATGTTAGTCGTCGTAAAAAAAAAAAAAAACTCTCCAGGGT