Previous Contig 010811:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005G16Sequence441010811 (8)gb:AJ619692_18122053e-06Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.770010811 (8)gb:AJ619692_18122057e-81Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.
JMFF007I01Sequence521010811 (8)gb:AJ619692_18122051e-32Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.653010811 (8)gb:AJ619692_18122051e-72Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.
JMFF026D16Sequence534010811 (8)gb:AJ619692_18122051e-49Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.725010811 (8)gb:AJ619692_18122054e-84Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.
JMFF048G09Sequence313010811 (8)gb:AJ619692_18122055e-17Medicago truncatula rhoGDI2 gene for Rho GDP dissociation inhibitor 2.548010811 (8)sp|Q9SFC6|GDIR_ARATH4e-41Rho GDP-dissociation inhibitor 1 (Rho GDI-1).>gb:ATAC013483_1543550 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005G16- AAAGAACCAACTCTTATGTCACCCAATTCTGCAT
                      ____________________________________________________________
consensus AAAGAACCAACTCTTATGTCACCCAATTCTGCAT
 
. : . : . : . : . : . :
JMFF005G16- CCCTTTAAATAAAGTTTGATTCTTTTTAGGAACTCTCTCTCTTTCTCTCTGTCTGTATTG
                      ____________________________________________________________
consensus CCCTTTAAATAAAGTTTGATTCTTTTTAGGAACTCTCTCTCTTTCTCTCTGTCTGTATTG
 
. : . : . : . : . : . :
JMFF005G16- TGTGTGTTTACGTGATTCTTGATTTGGCTTTGAGCTTTGTTCGCTTTGTCATGTCAGATA
JMFF007I01- TTGAGCTTTGTTCGCTTTGTCATGTCAGATA
                      ____________________________________________________________
consensus TGTGTGTTTACGTGATTCTTGATTTGGCTTTGAGCTTTGTTCGCTTTGTCATGTCAGATA
 
. : . : . : . : . : . :
JMFF005G16- TATAGTAGAGGCCTTGTTTTTATCCTGTGGGTGTGATTGGCTGCCGGGGGGCTTCAGAAA
JMFF048G09- GTGATTGGCTGCCGGGGGGCTTCAGAAA
JMFF007I01- TATAGTAGAGGCCTTGTTTTTATCCTGTGGGTGTGATTGGCTGCCGGGGGGCTTCAGAAA
JMFF026D16- GTGATTGGCTGCCGGGGGGCTTCAGAAA
                      ____________________________________________________________
consensus TATAGTAGAGGCCTTGTTTTTATCCTGTGGGTGTGATTGGCTGCCGGGGGGCTTCAGAAA
 
. : . : . : . : . : . :
JMFF005G16- ACATGGGGTTTGATGAGAAGAAAGGGGAGGATAAGAAGGAGGCTACTGCAGTTGCAGATT
JMFF048G09- ACATGGGGTTTGATGAGAAGAAAGGGGAGGATAAGAAGGAGGCTACTGCAGTTGCAGATT
JMFF007I01- ACATGGGGTTTGATGAGAAGAAAGGGGAGGATAAGAAGGAGGCTACTGCAGTTGCAGATT
JMFF026D16- ACATGGGGTTTGATGAGAAGAAAGGGGAGGATAAGAAGGAGGCTACTGCAGTTGCAGATT
                      ____________________________________________________________
consensus ACATGGGGTTTGATGAGAAGAAAGGGGAGGATAAGAAGGAGGCTACTGCAGTTGCAGATT
 
. : . : . : . : . : . :
JMFF005G16- CAGATGCTGAGACTGACAATGAAGGAGGTGGAGGGAGGCCGATGAGTGAGAGCTCCTTTT
JMFF048G09- CAGATGCTGAGACTGACAATGAAGGAGGTGGAGGGAGGCCGATGAGTGAGAGCTCCTTTT
JMFF007I01- CAGATGCTGAGACTGACAATGAAGGAGGTGGAGGGAGGCCGATGAGTGAGAGCTCCTTTT
JMFF026D16- CAGATGCTGAGACTGACAATGAAGGAGGTGGAGGGAGGCCGATGAGTGAGAGCTCCTTTT
                      ____________________________________________________________
consensus CAGATGCTGAGACTGACAATGAAGGAGGTGGAGGGAGGCCGATGAGTGAGAGCTCCTTTT
 
. : . : . : . : . : . :
JMFF005G16- GCACCACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
JMFF048G09- GCACCACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
JMFF007I01- GCACCACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
JMFF026D16- GCACCACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
rJMFF026D16+ ACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
rJMFF005G16+ CACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
                      ____________________________________________________________
consensus GCACCACTGAGGAGGAGGAGGAGGACACTGCAAATAAGATTCAGTTGGGGCCTCAAGTTA
 
. : . : . : . : . : . :
JMFF005G16- CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGA
JMFF048G09- CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
JMFF007I01- CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
JMFF026D16- CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
rJMFF026D16+ CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
rJMFF007I01+ AAAGATAAGGATGANGAGAGCTTGAGAAGGTGGAAGGAGC
rJMFF005G16+ CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
                      ____________________________________________________________
consensus CTCTCAAAGAACAGTTTGAGAAAGATAAGGATGATGAGAGCTTGAGAAGGTGGAAGGAGC
 
. : . : . : . : . : . :
JMFF048G09- AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGG
JMFF007I01- AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
JMFF026D16- AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
rJMFF026D16+ AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
rJMFF007I01+ AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
rJMFF005G16+ AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
                      ____________________________________________________________
consensus AACTTCTTGGGAGTGTGGATATCAATGCTGTTGGAGAATCTCTGGAAGCAGAAGTGAAGA
 
. : . : . : . : . : . :
JMFF007I01- TATTGAGCCTTTCCATGCTATCTCCTGGTANACCTGATATCGTTCTCCCAATCCCGAGGG
JMFF026D16- TATTGAGCCTTTCCATGCTATCTCCTGGTAGACCTGATATCGTTCTCCCAATCCCGAGGG
rJMFF026D16+ TATTGAGCCTTTCCATGCTATCTCCTGGTAGACCTGATATCGTTCTCCCAATCCCGAGGG
rJMFF007I01+ TATTGAGCNTTTCCATGCTATCTCNTGGTAGACCTGATATCGTTCTCCCAATCCCGAGGG
rJMFF005G16+ TATTGAGCCTTTCCATGCTATCTCCTGGTAGACCTGATATCGTTCTCCCAATCCCGAGGG
                      ____________________________________________________________
consensus TATTGAGCCTTTCCATGCTATCTCCTGGTAGACCTGATATCGTTCTCCCAATCCCGAGGG
 
. : . : . : . : . : . :
JMFF007I01- ATGGAAATCCTCCTANCCCGTGGTTCATATTGAAANAANGGAGTCNTTACANCCTTAAAT
JMFF026D16- ATGGAAATCCTCCTAGCCCGTGGTTCATATTGAAAGAAGGGAGTCGTTACAGCCTTAAAT
rJMFF026D16+ ATGGAAATCCTCCTAGCCCGTGGTTCATATTGAAAGAAGGGAGTCGTTACAGCCTTAAAT
rJMFF007I01+ ATGGAAATCCTCCTAGCCCGTGGTTCATATTGAAAGAAGGGAGTCGTTACAGCCTTAAAT
rJMFF005G16+ ATGGAAATCCTCCTAGCCCGTGGTTCATATTGAAAGAAGGGAGTCGTTACAGCCTTAAAT
rJMFF048G09+ CCTTAAAT
                      ____________________________________________________________
consensus ATGGAAATCCTCCTAGCCCGTGGTTCATATTGAAAGAAGGGAGTCGTTACAGCCTTAAAT
 
. : . : . : . : . : . :
JMFF007I01- TTGCAT
JMFF026D16- TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
rJMFF026D16+ TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
rJMFF007I01+ TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
rJMFF005G16+ TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
rJMFF048G09+ TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
                      ____________________________________________________________
consensus TTGCATTTCAGGTCAGCAATAACATAGTTTCTGGTCTGAAATACACAAACACAGTATGGA
 
. : . : . : . : . : . :
JMFF026D16- AAACTGGCATGAAAGTGGATGGATCA
rJMFF026D16+ AAACTGGCATGAAAGTGGATGGATCAAAAGAAATGATTGGGACCTTTAGTCCTCAACTGG
rJMFF007I01+ AAACTGGCATGAAAGTGGATGGATCAAAAGAAATGATTGGGACCTTTAGTCCTCAACTGG
rJMFF005G16+ AAACTGGCATGAAAGTGGATGGATCAAAAGAAATGATTGGGACCTTTAGTCCTCAACTGG
rJMFF048G09+ AAACTGGCATGAAAGTGGATGGATCAAAAGAAATGATTGGGACCTTTAGTCCTCAACTGG
                      ____________________________________________________________
consensus AAACTGGCATGAAAGTGGATGGATCAAAAGAAATGATTGGGACCTTTAGTCCTCAACTGG
 
. : . : . : . : . : . :
rJMFF026D16+ AGCCTTATACTCATGAAATGCCAGAAGAGACAACGCCCTCTGGGATGTTTGCTAGAGGAT
rJMFF007I01+ AGCCTTATACTCATGAAATGCCAGAAGAGACAACGCCCTCTGGGATGTTTGCTAGAGGAT
rJMFF005G16+ AGCCTTATACTCATGAAATGCCAGAAGAGACAACGCCCTCTGGGATGTTTGCTAGAGGAT
rJMFF048G09+ AGCCTTATACTCATGAAATGCCAGAAGAGACAACGCCCTCTGGGATGTTTGCTAGAGGAT
                      ____________________________________________________________
consensus AGCCTTATACTCATGAAATGCCAGAAGAGACAACGCCCTCTGGGATGTTTGCTAGAGGAT
 
. : . : . : . : . : . :
rJMFF026D16+ CATACTCCGCGAAGACAAAGTTCCTTGATGACGATAATAAGTGTCACCTGGAGATCAACT
rJMFF007I01+ CATACTCCGCGAAGACAAAGTTCCTTGATGACGATAATAAGTGTCACCTGGAGATCAACT
rJMFF005G16+ CATACTCCGCGAAGACAAAGTTCCTTGATGACGATAATAAGTGTCACCTGGAGATCAACT
rJMFF048G09+ CATACTCCGCGAAGACAAAGTTCCTTGATGACGATAATAAGTGTCACCTGGAGATCAACT
                      ____________________________________________________________
consensus CATACTCCGCGAAGACAAAGTTCCTTGATGACGATAATAAGTGTCACCTGGAGATCAACT
 
. : . : . : . : . : . :
rJMFF026D16+ ATACATTTGAAATCAAGAAAGAATGGCCTGCAACAGGGTAATCTTGAACATTGTTACCTG
rJMFF007I01+ ATACATTTGAAATCAAGAAAGAATGGCCTGCAACAGGGTAATCTTGAACATTGTTACCTG
rJMFF005G16+ ATACATTTGAAATCAAGAAAGAATGGCCTGCAACAGGGTAATCTTGAACATTGTTACCTG
rJMFF048G09+ ATACATTTGAAATCAAGAAAGAATTGCCTGCAACAGGGTAATCTTGAACATTGTTACCTG
                      ____________________________________________________________
consensus ATACATTTGAAATCAAGAAAGAATGGCCTGCAACAGGGTAATCTTGAACATTGTTACCTG
 
. : . : . : . : . : . :
rJMFF026D16+ GGATGTTTCTTTTTGTTCATCATTAGTTAATTATGTTTGTCTTTTCCACTGGTTTTTTTC
rJMFF007I01+ GGATGTTTCTTTTTGTTCATCATTAGTTAATTATGTTTGTCTTTTCCACTGGTTTTTTTC
rJMFF005G16+ GGATGTTTCTTTTTGTTCATCATTAGTTAATTATGTTTGTCTTTTCCACTGGTTTTTTTC
rJMFF048G09+ GGATGTTTCTTTTTGTTCATCATTAGTTAATTATGTTTGTCTTTTCCACTGGTTTTTTTC
                      ____________________________________________________________
consensus GGATGTTTCTTTTTGTTCATCATTAGTTAATTATGTTTGTCTTTTCCACTGGTTTTTTTC
 
. : . : . : . : . : . :
rJMFF026D16+ TGGAGAGGAAAGGGGAAAACTCCTGCTGCACTTGATAGGAGTGGTAGAACTTATAGCAAG
rJMFF007I01+ TGGAGAGGAAAGGGGAAAACTCCTGCTGCACTTGATAGGAGTGGTAGAACTTATAGCAAG
rJMFF005G16+ TGGAGAGGAAAGGGGAAAACTCCTGCTGCACTTGATAGGAGTGGTAGAACTTATAGCAAG
rJMFF048G09+ TGGAGAGGAAAGGGGAAAACTCCTGCTGCACTTGATAGGAGTGGTAGAACTTATAGCAAG
                      ____________________________________________________________
consensus TGGAGAGGAAAGGGGAAAACTCCTGCTGCACTTGATAGGAGTGGTAGAACTTATAGCAAG
 
. : . : . : . : . : . :
rJMFF026D16+ TTAGATTTTT
rJMFF007I01+ TTAGATTTTT
rJMFF005G16+ TTAGATTTTTTGTTTGTTTTTGTTTGTTTTTTGTTTTGTTTTGTTCAATAAAGTTGAGTT
rJMFF048G09+ TTAGATTTTTTGTTTGTTTTTGTTTGTTTTTTGTTTTGTTTTGTTCAATAAAGTTGAGTT
                      ____________________________________________________________
consensus TTAGATTTTTTGTTTGTTTTTGTTTGTTTTTTGTTTTGTTTTGTTCAATAAAGTTGAGTT
 
. : . : . : . : . : . :
rJMFF005G16+ TTGGACCATTACATT
rJMFF048G09+ TTGGACCATTACATTTTGGAATGCCTTTGGTTTATGTATTTACTTGGGTGTTTGTTTTCT
                      ____________________________________________________________
consensus TTGGACCATTACATTTTGGAATGCCTTTGGTTTATGTATTTACTTGGGTGTTTGTTTTCT