Previous Contig 010810:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N20Sequence380001125 (17)gb:AF082892_17667022e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c780010810 (14)gb:AF082891_17667019e-99Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF002N22Sequence537001125 (17)gb:AF082892_17667025e-40Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c708010810 (14)gb:AF082891_17667012e-83Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF004B13Sequence253001125 (17)685010810 (14)gb:AY508112_16102327e-90Lycopersicon esculentum cystathionine gamma synthase mRNA, complete cds.
JMFF011J03Sequence510001125 (17)gb:AF082892_17667027e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c713010810 (14)gb:AF082891_17667016e-99Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF012C09Sequence412001125 (17)gb:AF082892_17667026e-25Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c729010810 (14)gb:AF082891_1766701e-102Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF017G10Sequence541001125 (17)gb:AF082892_17667028e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c808010810 (14)gb:AF082891_1766701e-117Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF022N12Sequence409001125 (17)gb:AF082892_17667025e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c750010810 (14)gb:AF082891_1766701e-105Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF048F21Sequence292001125 (17)gb:AF082892_17667024e-11Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c221010810 (14)
JMFF051E11Sequence607001125 (17)gb:AF082892_17667022e-39Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c616010810 (14)gb:AF082891_17667015e-69Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFN032F09Sequence615010810 (14)gb:AF082891_17667017e-90Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFN041H01Sequence622010810 (14)gb:AF082891_1766701e-108Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMSF016I02Sequence426001125 (17)gb:AF082892_17667022e-33Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c750010810 (14)gb:AF082891_17667014e-94Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMSF030G07Sequence510001125 (17)gb:AF082892_17667027e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c736010810 (14)gb:AF082891_1766701e-106Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMSF039N17Sequence656001125 (17)gb:AF082892_17667021e-57Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c889010810 (14)gb:AF082891_1766701e-122Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017G10+ AAGGC
rJMSF039N17+ TTCAGATGTGTTGACATTGAGCTGGTTTCAAGGC
                      ____________________________________________________________
consensus TTCAGATGTGTTGACATTGAGCTGGTTTCAAGGC
 
. : . : . : . : . : . :
rJMSF030G07+ CTCTCAACC
JMFN041H01- TTGGTTTGCATAGATGGAACATTTGCTACTCCTCTCAACC
rJMFF017G10+ TTTGCCATGAAAAAGGTGCCTTGGTTTGCATAGATGGAACATTTGCTACTCCTCTCAACC
rJMFF022N12+ TCAACC
rJMFF004B13+ CTCTCAACC
rJMSF039N17+ TTTGCCATGAAAAAGGTGCCTTGGTTTGCATAGATGGAACATTTGCTACTCCTCTCAACC
                      ____________________________________________________________
consensus TTTGCCATGAAAAAGGTGCCTTGGTTTGCATAGATGGAACATTTGCTACTCCTCTCAACC
 
. : . : . : . : . : . :
rJMSF030G07+ AAAAGGCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
JMFN041H01- AAAAGGCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
rJMFF017G10+ AAAAGGCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
rJMFF022N12+ AAAAGNCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
rJMFF012C09+ CTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
rJMFF011J03+ TCTGCATTCCGCAACAA-AATTCATTGGG
rJMFF004B13+ AAAAGGCCTTAGCTCTCGGTGCTGACNTTGTTNTGCATTCCGCAACAANAATTCATTGGG
rJMSF039N17+ AAAAGGCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
rJMSF016I02+ GG
rJMFF002N20+ CATTCCGCAACAA-AATTCATTGGG
                      ____________________________________________________________
consensus AAAAGGCCTTAGCTCTCGGTGCTGACCTTGTTCTGCATTCCGCAACAA-AATTCATTGGG
 
. : . : . : . : . : . :
rJMSF030G07+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
JMFN041H01- GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF017G10+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF022N12+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF012C09+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF011J03+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF004B13+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMSF039N17+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMSF016I02+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
JMFN032F09- GGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF002N20+ GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
rJMFF002N22+ TTTCAGTTGTT
                      ____________________________________________________________
consensus GGACATAATGATGTACTGGCAGGATGCATTAGTGGACCTGAAAAGTTGGTTTCAGTTGTT
 
. : . : . : . : . : . :
rJMSF030G07+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
JMFN041H01- CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF017G10+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF022N12+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF012C09+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF011J03+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF004B13+ CGTAACTTGCATCATATCNTGGGCGGTACTCTTAATCNTAATGCTGCATATCTTATCATC
rJMSF039N17+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMSF016I02+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
JMFN032F09- CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF002N20+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
rJMFF002N22+ CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
                      ____________________________________________________________
consensus CGTAACTTGCATCATATCCTGGGCGGTACTCTTAATCCTAATGCTGCATATCTTATCATC
 
. : . : . : . : . : . :
rJMSF030G07+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
JMFN041H01- CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF017G10+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF022N12+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF012C09+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF011J03+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF004B13+ CGAGGCATGAAAACGNTGCATCTTCGTGTACAGCAACAAAANTCAACAGCATTGAGGATG
rJMSF039N17+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMSF016I02+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
JMFN032F09- CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF051E11+ GCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF002N20+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
rJMFF002N22+ CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
                      ____________________________________________________________
consensus CGAGGCATGAAAACGCTGCATCTTCGTGTACAGCAACAAAACTCAACAGCATTGAGGATG
 
. : . : . : . : . : . :
rJMSF030G07+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
JMFN041H01- GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF017G10+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF022N12+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF012C09+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF011J03+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF004B13+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGANGTGTNTATTATCCTGGCTTGCCAAGC
rJMSF039N17+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMSF016I02+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
JMFN032F09- GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF051E11+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF002N20+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
rJMFF002N22+ GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
                      ____________________________________________________________
consensus GCCGAAGTTTTAGAGGCCCATCCAAAGGTGAGACGTGTCTATTATCCTGGCTTGCCAAGC
 
. : . : . : . : . : . :
rJMSF030G07+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
JMFN041H01- CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF017G10+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF022N12+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF012C09+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF011J03+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF004B13+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGT-TTGTCAGTTTT
rJMSF039N17+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMSF016I02+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
JMFN032F09- CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF051E11+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF002N20+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
rJMFF002N22+ CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
                      ____________________________________________________________
consensus CATCCGGAACATCACATTGCAAAGAAGCAAATGACTGGGTTTGGTGGTGTTGTCAGTTTT
 
. : . : . : . : . : . :
rJMSF030G07+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
JMFN041H01- GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF017G10+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF022N12+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF012C09+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF011J03+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF004B13+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMSF039N17+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMSF016I02+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
JMFN032F09- GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF051E11+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF002N20+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
rJMFF002N22+ GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
                      ____________________________________________________________
consensus GAGATTGATGGGGACCTGATGACCACTGCAAAATTTGTGGACGCACTGAAAATTCCATAC
 
. : . : . : . : . : . :
rJMSF030G07+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
JMFN041H01- ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF017G10+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF022N12+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF012C09+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF011J03+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF004B13+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMSF039N17+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMSF016I02+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
JMFN032F09- ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF051E11+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF002N20+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
rJMFF002N22+ ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
                      ____________________________________________________________
consensus ATTGCCCCATCCTTTGGTGGATGTGAGAGCATCGTGGACCAGCCCGCAATTATGTCTTAT
 
. : . : . : . : . : . :
rJMSF030G07+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
JMFN041H01- TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF017G10+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF022N12+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF012C09+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF011J03+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF004B13+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTNGATTC
rJMSF039N17+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMSF016I02+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
JMFN032F09- TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF051E11+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF002N20+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
rJMFF002N22+ TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
                      ____________________________________________________________
consensus TGGGATCTTACTCAGGCAGAAAGGGCGGCGTATGGAATCATGGACAACTTGGTTCGATTC
 
. : . : . : . : . : . :
rJMSF030G07+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
JMFN041H01- AGCTTCGGGGTGGAGGACTTTGAAGA
rJMFF017G10+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF022N12+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF012C09+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF011J03+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF004B13+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMSF039N17+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMSF016I02+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
JMFN032F09- AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF051E11+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGGGACC
rJMFF002N20+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
rJMFF002N22+ AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
                      ____________________________________________________________
consensus AGCTTCGGGGTGGAGGACTTTGAAGACGTGAAAGCTGATGTTCTTCAGGCTCTAGAGACC
 
. : . : . : . : . : . :
rJMSF030G07+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF017G10+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF022N12+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF012C09+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF011J03+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF004B13+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTCCCGTGCTTTTCCCATTTCTGT
rJMSF039N17+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMSF016I02+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
JMFN032F09- ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF051E11+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF002N20+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF002N22+ ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
rJMFF048F21+ GCAATTTGTTTTTCCCCTTTCGGGGCTTTTCCCATTTCTGT
                      ____________________________________________________________
consensus ATATAGGGCGTCTGACCTTGCAATTTGTTCTTCCCCTTTCCGTGCTTTTCCCATTTCTGT
 
. : . : . : . : . : . :
rJMSF030G07+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTT
rJMFF017G10+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF022N12+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF012C09+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF011J03+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF004B13+ TTTAGTCATTCTAGTTG
rJMSF039N17+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMSF016I02+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
JMFN032F09- TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTAC
rJMFF051E11+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF002N20+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF002N22+ TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
rJMFF048F21+ TTTAGTCATTCTAGTGGGTTGGCTGGTTTCTTTTACGTAGATTGTGGAATTCGCACTTTG
                      ____________________________________________________________
consensus TTTAGTCATTCTAGTTGGTTTGCTTGTTTCTTTTACTTAGATTGTTGAATTCGCACTTTG
 
. : . : . : . : . : . :
rJMFF017G10+ TTCGCCGTTCCCAATTCGATCAAA
rJMFF022N12+ TTCGCCGTTCCCAATTCGATCAAAT
rJMFF012C09+ TTCGCCGTTCCCAATTCGATCAAA
rJMFF011J03+ TTCGCCGTTCCCAATTCGATCAAAT
rJMSF039N17+ TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAAGTGTG
rJMSF016I02+ TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAAGTGTG
rJMFF051E11+ TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAA
rJMFF002N20+ TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAAGTGTG
rJMFF002N22+ TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAAGTGTG
rJMFF048F21+ TTCGCCGTTCCCAATTCGATCAAATGTTATTGGCTTCCTCTTTGGAACTGGGCAAGGGTG
                      ____________________________________________________________
consensus TTCGCCGTTCCCAATTCGATCAAATGTTATCTGCTTCCTCTTTTGAACTGTGCAAGTGTG
 
. : . : . : . : . : . :
rJMSF039N17+ CTACACTCCTCTTTCT
rJMSF016I02+ CTACACTCCTCTTTCTTGTATGATTC
rJMFF002N20+ CTACACTCCTCTTTCTTGTATGATTCTTAACATTAA
rJMFF002N22+ CTACACTCCTCTTTCTTGTATGATTCTTAACATTAA
rJMFF048F21+ CTCCACTCCTCTTTCTGGTAGGATTCTTACCATTAACGGAATGGAGTGTATGTAAAGCAT
                      ____________________________________________________________
consensus CTACACTCCTCTTTCTTGTATGATTCTTAACATTAACGGAATGGAGTGTATGTAAAGCAT