Previous Contig 010808:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007K04Sequence551010808 (9)gb:AB085684_15244171e-24Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.710010808 (9)gb:AB085684_15244173e-64Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMFF020H21Sequence367010808 (9)gb:GMU64915_16807289e-13Glycine max farnesylated protein GMFP4 mRNA, partial cds.
JMFF048E23Sequence568010808 (9)gb:AB085684_15244173e-26Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.477010808 (9)gb:AB085684_15244171e-25Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMFF051A23Sequence623010808 (9)gb:AB085684_15244173e-27Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.410010808 (9)gb:GMU64915_16807287e-16Glycine max farnesylated protein GMFP4 mRNA, partial cds.
JMFN004J09Sequence641010808 (9)gb:AB085684_15244172e-42Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMSF047O13Sequence653020411gb:AY034961_15597422e-26Arabidopsis thaliana unknown protein (At1g12370) mRNA, complete cds.>gb:AY113909582010808 (9)gb:AB085684_15244174e-59Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007K04- GCCTTTCCCTGTTTTTAGTTTCCACACCATT
JMFF048E23- GCCTTTCCCTGTTTTTAGTTTCCACACCATT
                      ____________________________________________________________
consensus GCCTTTCCCTGTTTTTAGTTTCCACACCATT
 
. : . : . : . : . : . :
JMFF007K04- CTCTCTTTCTCTCTCTATCTCTCTACCTGTCTGTCTTTCTCTCTCTAAAATTTTCTACCC
JMFF048E23- CTCTCTTTCTCTCTCTATCTCTCTACCTGTCTGTCTTTCTCTCTCTAAAATTTTCTACCC
                      ____________________________________________________________
consensus CTCTCTTTCTCTCTCTATCTCTCTACCTGTCTGTCTTTCTCTCTCTAAAATTTTCTACCC
 
. : . : . : . : . : . :
JMFF007K04- ATTTCACCTCCCACGTCTCCATCTCCTGGAAGGCTCGAATCTTCTAAGCTTGTTATCTGA
JMFF048E23- ATTTCACCTCCCACGTCTCCATCTCCTGGAAGGCTCGAATCTTCTAAGCTTGTTATCTGA
JMFF051A23- A
JMFN004J09- A
                      ____________________________________________________________
consensus ATTTCACCTCCCACGTCTCCATCTCCTGGAAGGCTCGAATCTTCTAAGCTTGTTATCTGA
 
. : . : . : . : . : . :
JMFF007K04- AAGGTGAGGATTTAATGAATTAGCTGAGAAGTATCTCTGGAGCTGCGGATTGAGAGCTTT
JMFF048E23- AAGGTGAGGATTTAATGAATTAGCTGAGAAGTATCTCTGGAGCTGCGGATTGAGAGCTTT
JMFF051A23- AAGGTGAGGATTTAATGAATTAGCTGAGAAGTATCTCTGGAGCTGCGGATTGAGAGCTTT
JMFN004J09- AAGGTGAGGATTTAATGAATTAGCTGAGAAGTATCTCTGGAGCTGCGGATTGAGAGCTTT
                      ____________________________________________________________
consensus AAGGTGAGGATTTAATGAATTAGCTGAGAAGTATCTCTGGAGCTGCGGATTGAGAGCTTT
 
. : . : . : . : . : . :
JMFF007K04- TTCGGGACTTTTTCTACAATATGGCTTGTAAGGGGTGTTTGGAGTGCTTGCTGAAACTCT
JMFF048E23- TTCGGGACTTTTTCTACAATATGGCTTGTAAGGGGTGTTTGGAGTGCTTGCTGAAACTCT
JMFF051A23- TTCGGGACTTTTTCTACAATATGGCTTGTAAGGGGTGTTTGGAGTGCTTGCTGAAACTCT
JMFN004J09- TTCGGGACTTTTTCTACAATATGGCTTGTAAGGGGTGTTTGGAGTGCTTGCTGAAACTCT
                      ____________________________________________________________
consensus TTCGGGACTTTTTCTACAATATGGCTTGTAAGGGGTGTTTGGAGTGCTTGCTGAAACTCT
 
. : . : . : . : . : . :
JMFF007K04- TGAACTTCTTATTGACCCTTGCGGGTCTGGGCATGGTTGGATATGGTATCTACCTCTTTG
JMFF048E23- TGAACTTCTTATTGACCCTTGCGGGTCTGGGCATGGTTGGATATGGTATCTACCTCTTTG
JMFF051A23- TGAACTTCTTATTGACCCTTGCGGGTCTGGGCATGGTTGGATATGGTATCTACCTCTTTG
JMFN004J09- TGAACTTCTTATTGACCCTTGCGGGTCTGGGCATGGTTGGATATGGTATCTACCTCTTTG
                      ____________________________________________________________
consensus TGAACTTCTTATTGACCCTTGCGGGTCTGGGCATGGTTGGATATGGTATCTACCTCTTTG
 
. : . : . : . : . : . :
JMFF007K04- TGGAGTACAAAAACCATTCACCATCGGGTGATGATCATCCCATTCCCTTCCCACCCTCGA
JMFF048E23- TGGAGTACAAAAACCATTCACCATCGGGTGATGATCATCCCATTCCCTTCCCACCCTCGA
JMFF051A23- TGGAGTACAAAAACCATTCACCATCGGGTGATGATCATCCCATTCCCTTCCCACCCTCGA
JMFN004J09- TGGAGTACAAAAACCATTCACCATCGGGTGATGATCATCCCATTCCCTTCCCACCCTCGA
                      ____________________________________________________________
consensus TGGAGTACAAAAACCATTCACCATCGGGTGATGATCATCCCATTCCCTTCCCACCCTCGA
 
. : . : . : . : . : . :
JMFF007K04- GTGGTGAATTAGTGCAACTAGGTCGACCTATGCTCGTGGCTGTGTCTTTGGCCAACAACA
JMFF048E23- GTGGTGAATTAGTGCAACTAGGTCGACCTATGCTCGTGGCTGTGTCTTACCCCAACAACA
JMFF051A23- GTGGTGAATTAGTGCAACTAGGTCGACCTATGCTCGTGGCTGTGTCTTTGGCCAACAACA
JMFN004J09- GTGGTGAATTAGTGCAACTAGGTCGACCTATGCTCGTGGCTGTGTCTTTGGCCAACAACA
                      ____________________________________________________________
consensus GTGGTGAATTAGTGCAACTAGGTCGACCTATGCTCGTGGCTGTGTCTTTGGCCAACAACA
 
. : . : . : . : . : . :
JMFF007K04- TATTCGATAACCTTCCAAAAGAGTGGTTTTTATACTTGTTTATTGGTATTGGAGTGCTTC
JMFF048E23- TATTCGATAACCTTCCAAAAGAGTGGTTTTTATACTTGTTTATTGGTATTGGAGTGCTTC
JMFF051A23- TATTCGATAACCTTCCAAAAGAGTGGTTTTTATACTTGTTTATTGGTATTGGAGTGCTTC
JMFN004J09- TATTCGATAACCTTCCAAAAGAGTGGTTTTTATACTTGTTTATTGGTATTGGAGTGCTTC
                      ____________________________________________________________
consensus TATTCGATAACCTTCCAAAAGAGTGGTTTTTATACTTGTTTATTGGTATTGGAGTGCTTC
 
. : . : . : . : . : . :
JMFF007K04- TTTTTGTAATATCTTGCTTTGGTTGTATCGGAGCTTCAAC
JMFF048E23- TTTTTGTAATATCTTGCTTTGGTTGTATCGGAGCTTCAACAAGGAATGGGTGCTGCT
JMFF051A23- TTTTTGTAATATCTTGCTTTGGTTGTATCGGAGCTTCAACAAGGAATGGGTGCTGCTTGA
JMFN004J09- TTTTTGTAATATCTTGCTTTGGTTGTATCGGAGCTTCAACAAGGAATGGGTGCTGCTTGA
                      ____________________________________________________________
consensus TTTTTGTAATATCTTGCTTTGGTTGTATCGGAGCTTCAACAAGGAATGGGTGCTGCTTGA
 
. : . : . : . : . : . :
JMFF051A23- GTTGTTATTCAGTATTGGTGATCTTGCTGATCCTGGTTGAACTTGGAGCTGCTGCGTTTA
JMFN004J09- GTTGTTATTCAGTATTGGTGATCTTGCTGATCCTGGTTGAACTTGGAGCTGCTGCGTTTA
rJMFF007K04+ CTTGGAGCTGCTGCGTTTA
                      ____________________________________________________________
consensus GTTGTTATTCAGTATTGGTGATCTTGCTGATCCTGGTTGAACTTGGAGCTGCTGCGTTTA
 
. : . : . : . : . : . :
JMFF051A23- TTTTCTTTGATGAACGTTG
JMFN004J09- TTTTCTTTGATGAACGTTGGAAGAAGGAAATTCCAACTGACCGAACGGGTAACTTTGATA
rJMSF047O13+ TGGAAGAAGGAAATTCCAACTGACCGAACGGGTAACTTTGATA
rJMFF007K04+ TTTTCTTTGATGAACGTTGGAAGAAGGAAATTCCAACTGACCGAACGGGTAACTTTGATA
                      ____________________________________________________________
consensus TTTTCTTTGATGAACGTTGGAAGAAGGAAATTCCAACTGACCGAACGGGTAACTTTGATA
 
. : . : . : . : . : . :
JMFN004J09- TGATATATGAATT
rJMSF047O13+ TGATATATGAATTCCTAGAAGACAACTGGAAAATTGTCAAGTGGGTTGCCCTTGGGGCAG
rJMFF007K04+ TGATATATGAATTCCTAGAAGACAACTGGAAAATTGTCAAGTGGGTTGCCCTTGGGGCAG
                      ____________________________________________________________
consensus TGATATATGAATTCCTAGAAGACAACTGGAAAATTGTCAAGTGGGTTGCCCTTGGGGCAG
 
. : . : . : . : . : . :
rJMSF047O13+ TTGTTTTGGAGGCTTTAATGTTCTTGTTAGCTCTTGTGGTAAGGGCAGCAAACAGACCAG
rJMFF007K04+ TTGTTTTGGAGGCTTTAATGTTCTTGTTAGCTCTTGTGGTAAGGGCAGCAAACAGACCAG
                      ____________________________________________________________
consensus TTGTTTTGGAGGCTTTAATGTTCTTGTTAGCTCTTGTGGTAAGGGCAGCAAACAGACCAG
 
. : . : . : . : . : . :
rJMSF047O13+ CAGACTATGATAGTGATGATGAGTATATTGGCGGTCCAAGACAACAGATCCGCCAGCCCA
rJMFF007K04+ CAGACTATGATAGTGATGATGAGTATATTGGCGGTCCAAGACAACAGATCCGCCAGCCCC
                      ____________________________________________________________
consensus CAGACTATGATAGTGATGATGAGTATATTGGCGGTCCAAGACAACAGATCCGCCAGCCCC
 
. : . : . : . : . : . :
rJMSF047O13+ TAATGAACAACAGGCAACAAGCTCCTGTCACGGGTGTACCTGTTGCAGGTACCCTTGATT
rJMFF007K04+ TAATGAACAACAGGCAACAAGCTCCTGTCACGGGTGTACCTGTTGCAGGTACCCTTGATT
rJMFF048E23+ TAATGAACAACAGGCAACAAGCTCCTGTCACGGGTGTACCTGTTGCAGGTACCCTTGATT
                      ____________________________________________________________
consensus TAATGAACAACAGGCAACAAGCTCCTGTCACGGGTGTACCTGTTGCAGGTACCCTTGATT
 
. : . : . : . : . : . :
rJMSF047O13+ NTCGACCAAGCCGCAATGATGCTTGGAGTGCACGTATGAGGGAGAAGTATGGGCTTGACA
rJMFF007K04+ CTCGACCAAGCCGCAATGATGCTTGGAGTGCACGTATGAGGGAGAAGTATGGGCTTGACA
rJMFF051A23+ AAGCCGCAATGATGCTTGGAGTGCACGTATGAGGGAGAAGTATGGGCTTGACA
rJMFF020H21+ GACCAAGCCGCAATGATGCTTGGAGTGCACGTANGAGGGAGAAGTATGGGCTTGACA
rJMFF048E23+ CTCGACCAAGCCGCAATGATGCTTGGAGTGCACGTATGAGGGAGAAGTATGGGCTTGACA
                      ____________________________________________________________
consensus CTCGACCAAGCCGCAATGATGCTTGGAGTGCACGTATGAGGGAGAAGTATGGGCTTGACA
 
. : . : . : . : . : . :
rJMSF047O13+ CTTCAGAGTTCACGTACAATCCCTATGAGTCGAACCGCTACCAACCAACAAACGTACAAC
rJMFF007K04+ CTTCAGAGTTCACGTACAATCCCTNTGAGTCGAACCGCTACCAACCAACAAACGTACAAC
rJMFF051A23+ CTTCAGAGTTCACGTACAATCCCTTTGAGTCGAACCGTTACCAACCAACAAACGCACAAC
rJMFF020H21+ CTTCAGAGTTCNCGTACAATCCCTCNGAGTNGANCCGCTNCCANCCAACAAACGTACAAC
rJMFF048E23+ CTTCAGAGTTCACGTACAATCCCTCTGAGTCGAACCGCTACCAACCAACAAACGTACAAC
                      ____________________________________________________________
consensus CTTCAGAGTTCACGTACAATCCCTCTGAGTCGAACCGCTACCAACCAACAAACGTACAAC
 
. : . : . : . : . : . :
rJMSF047O13+ CAGCCGAGGAAAGAGGTCGTTGCACCATAATGTAATAGCGGTTNGGGTTTCTGACGCATG
rJMFF007K04+ CAGCCGAGGAAAGAGGTCGTTGCACCATAATGTAATAGCGGTTTGGGTTTCTGACGCATG
rJMFF051A23+ CAGCCGAGGAAAGAGGTCGTTGCACCATAATGTAATAGCGGTTTGGGTTTCTGACGCATG
rJMFF020H21+ CAGCCGAGGAAAGAGGTNGTTGCACCATAATGTAATAGCGGTTTGGGTTTNTGANGCATG
rJMFF048E23+ CAGCCGAGGAAAGAGGTCGTTGCACCATAATGTAATAGCGGTTTGGGTTTCTGACGCATG
                      ____________________________________________________________
consensus CAGCCGAGGAAAGAGGTCGTTGCACCATAATGTAATAGCGGTTTGGGTTTCTGACGCATG
 
. : . : . : . : . : . :
rJMSF047O13+ TCATCATGCACAATTATGTGAGCTGAATTTTTTNATTGGCTGGTACTAGTGTGTGTATCN
rJMFF007K04+ TCATCATGCACAATTATGTGAGCTGAATTTTTTGATTGGCTGGTACTAGTGTGTGTATCT
rJMFF051A23+ TCATCATGCACAATTATGTGAGCTGAATTTTTTGATTGGCTGGTACTAGTGTGTGTATCT
rJMFF020H21+ TCATCATGCACAATTATGTGAGCTGAATTTTTTGATTGGCTGGTACTAGTGTGNGTATCT
rJMFF048E23+ TCATCATGCACAATTATGTGAGCTGAATTTTTTGATTGGCTGGTACTAGTGTGTGTATCT
                      ____________________________________________________________
consensus TCATCATGCACAATTATGTGAGCTGAATTTTTTGATTGGCTGGTACTAGTGTGTGTATCT
 
. : . : . : . : . : . :
rJMSF047O13+ TTAGAGACGGTTT-CTGGTGTGAAGGATATATACACAAAACAAAGTTTCCGAATCCT
rJMFF007K04+ TTAGAGACGGTTT-CTGGTGTGAAGGATATATACACAAAACAAAGTTTCCGAATCCT-TA
rJMFF051A23+ TTAGAGACGGTTT-TTGGTGTGAAGGATATATACACAAAACAAAGTTTCCGAATCCT-TA
rJMFF020H21+ TTAGAGACGGTTTCCTGGTGTGAAGGATATATACACAAAACAAAGTTTCNGAATCCTCTA
rJMFF048E23+ TTAGAGACGGTTT-CTGGTGTGAAGGATATATACACAAAACAAAGTTTCCGAATCCT-TA
                      ____________________________________________________________
consensus TTAGAGACGGTTT-CTGGTGTGAAGGATATATACACAAAACAAAGTTTCCGAATCCT-TA
 
. : . : . : . : . : . :
rJMFF007K04+ -ATTGTAACTGCTGTTTGTTTTTAATTTAAGGGACAACATATGAATATGAACCCCAGAGG
rJMFF051A23+ -ATTGTAACTGCTGTTTGTTTTTAATTTAAGGGACAACATATGAATATGAACCCCAGAGG
rJMFF020H21+ CATTGTAANTNCTGTTTGTTTTTAATTTAAGGGACAACATATGAATATGNACCCCAGAGG
rJMFF048E23+ -ATTGTAACTGCTGTTTGTTTTTAATTTAAGGGACAACATATGAATATGAACCCCAGAGG
                      ____________________________________________________________
consensus -ATTGTAACTGCTGTTTGTTTTTAATTTAAGGGACAACATATGAATATGAACCCCAGAGG
 
. : . : . : . : . : . :
rJMFF007K04+ GTGAAAAATATTCAGTAATTTTCTTTCTTCTCCT
rJMFF051A23+ GTGAAAAATATTCAGTAATTTTCTTTCTTCTCCTTAATAAAAATGAAAAAAAAATGCATT
rJMFF020H21+ GTGAAAAATA
rJMFF048E23+ GTGAAAAATATTCAGTAATTTTCTTTCTTCTCCTTAATAAAAATGAAAAAAAAATGCATT
                      ____________________________________________________________
consensus GTGAAAAATATTCAGTAATTTTCTTTCTTCTCCTTAATAAAAATGAAAAAAAAATGCATT