Previous Contig 010807:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009L03Sequence549006576 (12)gb:AB010697_15112051e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705685010807 (11)gb:AB010697_15112054e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705
JMFF014E15Sequence737010807 (11)gb:AY088661_15736773e-39Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMFF018P15Sequence590006576 (12)gb:AB010697_15112051e-55Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705759010807 (11)gb:AY088661_15736771e-37Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMFF026B08Sequence564006576 (12)gb:AB010697_15112052e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705755010807 (11)gb:AY088661_15736771e-41Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMFF027H05Sequence554006576 (12)gb:AB010697_15112052e-51Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705756010807 (11)gb:AY088661_15736773e-45Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMFF039D11Sequence565006576 (12)gb:AB010697_15112052e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705716010807 (11)gb:AB010697_15112053e-32Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705
JMFF048E12Sequence370006576 (12)gb:AB010697_15112055e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705331010807 (11)
JMSF028L17Sequence645006576 (12)gb:AB010697_15112054e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705737010807 (11)gb:AY088661_15736775e-39Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMSF029E10Sequence670006576 (12)gb:AB010697_15112055e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705739010807 (11)gb:AY088661_15736773e-45Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMSF029H22Sequence670006576 (12)gb:AB010697_15112051e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705751010807 (11)gb:AY088661_15736771e-45Arabidopsis thaliana clone 8987 mRNA, complete sequence.
JMSF043D23Sequence771006576 (12)gb:AB010697_15112051e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9.>gb:AY085521_15705804010807 (11)gb:AY088661_15736778e-53Arabidopsis thaliana clone 8987 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009L03+ GATTGGGTCCCGCCGGCCAACCC
                      ____________________________________________________________
consensus GATTGGGTCCCGCCGGCCAACCC
 
. : . : . : . : . : . :
rJMFF009L03+ NTAAGGATCAAGTACACCCAGCTCCTCAAAAACCCCCGGAGATCCTCCCTNTANTACGTC
                      ____________________________________________________________
consensus NTAAGGATCAAGTACACCCAGCTCCTCAAAAACCCCCGGAGATCCTCCCTNTANTACGTC
 
. : . : . : . : . : . :
rJMFF009L03+ AACCTCGTCGGAATCAAGGTCGGCCGGCGAGTCGTCGATATCCCTCCCAGCGCATTGGCT
                      ____________________________________________________________
consensus AACCTCGTCGGAATCAAGGTCGGCCGGCGAGTCGTCGATATCCCTCCCAGCGCATTGGCT
 
. : . : . : . : . : . :
rJMFF009L03+ TTCAACCCGGTCACCGGCTCCGGCACCGTCATCGATTCCGGAACGGTGTTCACGCGGCTG
rJMSF028L17+ TCCGGAACGGTGTTCACGCGGCTG
rJMSF029H22+ ATTCCGGAACGGTGTTCACGCGGCTG
rJMSF029E10+ ATTCCGGAACGGTGNTCACGCGGCTG
rJMSF043D23+ TCATCGATTCCGGAACGGTGTTCACGCGGCTG
rJMFF027H05+ GGAACGGTGTTCACGCGGCTG
rJMFF018P15+ GGAACGGTGTTCACGCGGCTG
rJMFF026B08+ ACGCGGCTG
                      ____________________________________________________________
consensus TTCAACCCGGTCACCGGCTCCGGCACCGTCATCGATTCCGGAACGGTGTTCACGCGGCTG
 
. : . : . : . : . : . :
rJMFF009L03+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMSF028L17+ GTGGAGCCGGGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMSF029H22+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMSF029E10+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMSF043D23+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMFF027H05+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMFF018P15+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMFF026B08+ GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
rJMFF039D11+ AGTTCCGGCGGNGAATGGGGCGGAACAC
rJMFF014E15+ CGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
                      ____________________________________________________________
consensus GTGGAGCC-GGCGTACGTAGCCGTGAGAAACGAGTTCCGGCGGCGAATGGGGCGGAACAC
 
. : . : . : . : . : . :
rJMFF009L03+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMSF028L17+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMSF029H22+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMSF029E10+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMSF043D23+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMFF027H05+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMFF018P15+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMFF026B08+ GACGGTGACGTCACTAGGA-GGGTTCGACACGGGCTACACGGTGCCGGTGACGGTGCCGA
rJMFF039D11+ GACGGTGACGTCACTAGGAGGGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
rJMFF014E15+ GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
                      ____________________________________________________________
consensus GACGGTGACGTCACTAGGA-GGGTTCGACACGTGCTACACGGTGCCGGTGACGGTGCCGA
 
. : . : . : . : . : . :
rJMFF009L03+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMSF028L17+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMSF029H22+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMSF029E10+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMSF043D23+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMFF027H05+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMFF018P15+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGATCC
rJMFF026B08+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMFF039D11+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
rJMFF014E15+ CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
                      ____________________________________________________________
consensus CCATAACTTTTATGTTCCAGGGGATGAACGTGACGCTGCCGCAAGACAACTTCTTGAT-C
 
. : . : . : . : . : . :
rJMFF009L03+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMSF028L17+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMSF029H22+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMSF029E10+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMSF043D23+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMFF027H05+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMFF018P15+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMFF026B08+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMFF039D11+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
rJMFF014E15+ CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
                      ____________________________________________________________
consensus CACAGCACGGCGGGGAGCACCACCTGCCTGGCCATCGCCGCCGCGCCGGACAACCTCAAC
 
. : . : . : . : . : . :
rJMFF009L03+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMSF028L17+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACTTC
rJMSF029H22+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMSF029E10+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMSF043D23+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMFF027H05+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMFF018P15+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMFF026B08+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMFF039D11+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
rJMFF014E15+ TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
                      ____________________________________________________________
consensus TCCGTCCTCAACGTCATCGCCAACATGCAGCAGCAGAACCACCGCATCCTCTTCGACGTC
 
. : . : . : . : . : . :
rJMFF009L03+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMSF028L17+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMSF029H22+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMSF029E10+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMSF043D23+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMFF027H05+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMFF018P15+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMFF026B08+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMFF039D11+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
rJMFF014E15+ CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
                      ____________________________________________________________
consensus CCCAATTCAAGACTCGGCGTCGCCCGTGAACTTTGCAGCTAAACCGCCCGCCGGACGGCC
 
. : . : . : . : . : . :
rJMFF009L03+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMSF028L17+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMSF029H22+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMSF029E10+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMSF043D23+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMFF027H05+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMFF018P15+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMFF026B08+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMFF039D11+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
rJMFF014E15+ GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
                      ____________________________________________________________
consensus GGAGTGTTATATTATATTATAACATATAATCATGCATGCATATCATATCATATCATATCA
 
. : . : . : . : . : . :
rJMFF009L03+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMSF028L17+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMSF029H22+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMSF029E10+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMSF043D23+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF027H05+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF018P15+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF026B08+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF039D11+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF014E15+ CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
rJMFF048E12+ CGTGATCCAGAATTTGGTGTTTTGGATTGGAA
                      ____________________________________________________________
consensus CTGCTTTAATTAATTTTGCTAATTCAGTCGTGATCCAGAATTTGGTGTTTTGGATTGGAA
 
. : . : . : . : . : . :
rJMFF009L03+ ATCGG
rJMSF028L17+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMSF029H22+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMSF029E10+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMSF043D23+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF027H05+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF018P15+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF026B08+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF039D11+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF014E15+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
rJMFF048E12+ ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
                      ____________________________________________________________
consensus ATCGGTGAGATAATAAGTATTGGTGTTGGTGTTAGTGGGCAAGTTTAATTAATTTTATTA
 
. : . : . : . : . : . :
rJMSF028L17+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMSF029H22+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMSF029E10+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMSF043D23+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF027H05+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF018P15+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF026B08+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF039D11+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF014E15+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
rJMFF048E12+ ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
                      ____________________________________________________________
consensus ATTATGTTGTGATGAAGAATTTGATGTTTTGGATCGGAGACAGAATGAAGTGAGTAGGTA
 
. : . : . : . : . : . :
rJMSF028L17+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMSF029H22+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMSF029E10+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMSF043D23+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF027H05+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF018P15+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF026B08+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF039D11+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF014E15+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
rJMFF048E12+ CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
                      ____________________________________________________________
consensus CTAGGAATAGGATGTGGTTTTTGTGTCGTTGGAAAGAGGGAAATGAAGGCAGGGGGCATG
 
. : . : . : . : . : . :
rJMSF028L17+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT
rJMSF029H22+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMSF029E10+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGTC
rJMSF043D23+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGTCCACG
rJMFF027H05+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMFF018P15+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMFF026B08+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMFF039D11+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMFF014E15+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
rJMFF048E12+ GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
                      ____________________________________________________________
consensus GTGTGGGTCTTACGTTATGATGGTTTTGAAATTTGTGGAGTTTTAATTTGTGTGT-CACG
 
. : . : . : . : . : . :
rJMSF029H22+ GGGTCGTCC
rJMSF043D23+ GGGTCGTCCG
rJMFF027H05+ GGGTCGTCCGTCGTCGCAA
rJMFF018P15+ GGGTCGTCCGTCGTCGCAAAT
rJMFF026B08+ GGGTCGTCCGTCGTCGCAAATGCTTCCAAA
rJMFF039D11+ GGGTCGTCCGTCGTCGCAAATGCTTCCAAA
rJMFF014E15+ GGGTCGTCCGTCGTCGCAAATGCTTCCAAA
rJMFF048E12+ GGGTCGTCCGTCGTCGCAAATGCTTCCAAATAATAATAAATTTTTACGTACATTATTGCC
                      ____________________________________________________________
consensus GGGTCGTCCGTCGTCGCAAATGCTTCCAAATAATAATAAATTTTTACGTACATTATTGCC