Previous Contig 010799:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035K11Sequence571002054 (3)gb:AP004765_18446739e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071591010799 (5)gb:AB007646_15101702e-40Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MGI19.
JMFF041G07Sequence550010799 (5)gb:AP004765_18446738e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071561010799 (5)gb:AP004765_18446737e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071
JMFF048C20Sequence397002054 (3)gb:AP004765_18446730.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071273010799 (5)
JMFF048M20Sequence364002054 (3)310010799 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035K11+ TGGGGTCCAGATATGACAGACGAATTTCTTAAGGAA
                      ____________________________________________________________
consensus TGGGGTCCAGATATGACAGACGAATTTCTTAAGGAA
 
. : . : . : . : . : . :
rJMFF035K11+ GTGCAACCTAAAGTTGATCATCAGGTCACATGAAGGTCCAGATGCAAGGGAAAAGCGGCC
                      ____________________________________________________________
consensus GTGCAACCTAAAGTTGATCATCAGGTCACATGAAGGTCCAGATGCAAGGGAAAAGCGGCC
 
. : . : . : . : . : . :
rJMFF035K11+ TGGTCTCGGAGGAATGGATGCAGGGTACACTATAGATCATGTCGTGGAATCTGGGAAATT
rJMFF041G07+ AAATT
                      ____________________________________________________________
consensus TGGTCTCGGAGGAATGGATGCAGGGTACACTATAGATCATGTCGTGGAATCTGGGAAATT
 
. : . : . : . : . : . :
rJMFF035K11+ GATCACATTGTTTAGTGCGCCAGACTATCCGCAGTTTCAGGCTACGGAAGATAGGTACCG
rJMFF041G07+ GATCACATTGTTTAGTGCGCCAGACTATCCGCAGTTTCAGGCTACGGAAGATAGGTACCG
JMFF041G07- ATTGTTTAGTGCGCCAGACTATCCGCAGTTTCAGGCTACGGAAGATAGGTACCG
                      ____________________________________________________________
consensus GATCACATTGTTTAGTGCGCCAGACTATCCGCAGTTTCAGGCTACGGAAGATAGGTACCG
 
. : . : . : . : . : . :
rJMFF035K11+ AAATAAAGGAGCATACATCGTATTGGAACCTCCTGATTTCGACACTCCCATTTTCCATAG
rJMFF041G07+ AAATAAAGGAGCATACATCGTATTGGAACCTCCTGATTTCGACACTCCCATTTTCCATAG
JMFF041G07- AAATAAAGGAGCATACATCGTATTGGAACCTCCTGATTTCGACACTCCCATTTTCCATAG
                      ____________________________________________________________
consensus AAATAAAGGAGCATACATCGTATTGGAACCTCCTGATTTCGACACTCCCATTTTCCATAG
 
. : . : . : . : . : . :
rJMFF035K11+ CTTNGATGCAGTTACTCCCAGACCAAAGGCAAATCCATTNTATGATTTTGAAGATGTCAN
rJMFF041G07+ CTTTGATGCAGTTACTCCCAGACCAAAGGCAAATCCATTCTATGATTTTGAAGATGTC--
JMFF041G07- CTTTGATGCAGTTACTCCCAGACCAAAGGCAAATCCATTCTATGATTTTGAAGATGTC--
                      ____________________________________________________________
consensus CTTTGATGCAGTTACTCCCAGACCAAAGGCAAATCCATTCTATGATTTTGAAGATGTC--
 
. : . : . : . : . : . :
rJMFF035K11+ TGATTNTGATGAAGAGTTGGATTNGGCATCTATGGTCACATCATGATGATGGTGTCTCGA
rJMFF041G07+ --ATTCTGATGAAGAGTTGGATTTGGCATCTATGGTCACATCATGATGATGGTGTCTCGA
JMFF041G07- --ATTCTGATGAAGAGTTGGATTTGGCATCTATGGTCACATCATGATGATGGTGTCTCGA
                      ____________________________________________________________
consensus --ATTCTGATGAAGAGTTGGATTTGGCATCTATGGTCACATCATGATGATGGTGTCTCGA
 
. : . : . : . : . : . :
rJMFF035K11+ GGCCATTGTATAAAAACAGAAGATTTGAAGGCATAACAACAATAGTTCCAGNTGGTTGAG
rJMFF041G07+ GGCCATTGTATAAAAACAGAAGATTTGAAGGCATAACAACAATAGTTCCAGCTGGTTGAG
rJMFF048M20+ GTATAAAAACAGAAGATTTGAAGGCATAACAACAATAGTTCCAGCTGGTTGAG
JMFF041G07- GGCCATTGTATAAAAACAGAAGATTTGAAGGCATAACAACAATAGTTCCAGCTGGTTGAG
                      ____________________________________________________________
consensus GGCCATTGTATAAAAACAGAAGATTTGAAGGCATAACAACAATAGTTCCAGCTGGTTGAG
 
. : . : . : . : . : . :
rJMFF035K11+ GATGATAGGAACTTGNTTAACTTCAATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
rJMFF041G07+ GATGATAGGAACTTGGTTAACTTCAATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
rJMFF048M20+ GATGATAGGAACTTGGTTAACTTCAATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
JMFF041G07- GATGATAGGAACTTGGTTAACTTCAATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
rJMFF048C20+ ATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
                      ____________________________________________________________
consensus GATGATAGGAACTTGGTTAACTTCAATCCAATGGCGATTTAGGCTCGAAATGGAGTTTTG
 
. : . : . : . : . : . :
rJMFF035K11+ TATCATGACATCCATCGAAAATATGTATTTTAATGGTTGTTATCTTTGTGATGNTTCAGT
rJMFF041G07+ TATCATGACATCCATCG--AATATGTATTTT-TTGGTT-TTATTTTTGTGATGCTTCAGT
rJMFF048M20+ TATCATGACATCCATCGAAAATATGTATTTT-TTGGTT-TTATTTTTGTGATGCTTCAGT
JMFF041G07- TATCATGACATCCATCG--AATATGTATTTT-TTGGTT-TTATTTTTGTGATGCTTCAGT
rJMFF048C20+ TATCATGACATCCATCGAAAATATGTATTTT-TTGGTT-TTATTTTTGTGATGCTTCAGT
                      ____________________________________________________________
consensus TATCATGACATCCATCGAAAATATGTATTTT-TTGGTT-TTATTTTTGTGATGCTTCAGT
 
. : . : . : . : . : . :
rJMFF035K11+ TTACATTTTCCTCCT
rJMFF041G07+ TTACATTTTCCTCCTCTGATCTAGCTGACCTATCAGAATATGGAAGGGTCTTTAATGGTT
rJMFF048M20+ TTACATTTTCCTCCTCTGATCTAGCTGACCTATCAGAATATGGAAGGGTCTTTAATGGTT
JMFF041G07- TTACATTTTCCTCCTCTGATCTAGCTGACCTATCAGAATATGGAAGGGTCTTTAATGGTT
rJMFF048C20+ TTACATTTTCCTCCTCTGATCTAGCTGACCTATCAGAATATGGAAGGGTCTTTAATGGTT
                      ____________________________________________________________
consensus TTACATTTTCCTCCTCTGATCTAGCTGACCTATCAGAATATGGAAGGGTCTTTAATGGTT
 
. : . : . : . : . : . :
rJMFF041G07+ TGCTTGTGTATTGTACCAACATATGTTGTATACTGAGTAATCATTAAACTTGTTGTCTCA
rJMFF048M20+ TGCTTGTGTATTGTACCAACATATGTTGTATACTGAGTAATCATTAAACTTGTTGTCTCA
JMFF041G07- TGCTTGTGTATTGTACCAACATATGTTGTATACTGAGTAATCATTAAACTTGTTGTCTCA
rJMFF048C20+ TGCTTGTGTATTGTACCAACATATGTTGTATACTGAGTAATCATTAAACTTGTTGTCTCA
                      ____________________________________________________________
consensus TGCTTGTGTATTGTACCAACATATGTTGTATACTGAGTAATCATTAAACTTGTTGTCTCA
 
. : . : . : . : . : . :
rJMFF041G07+ GAAAACAATTCTGTTACAG
rJMFF048M20+ GAAAACAATTCTGTTACAG
JMFF041G07- GAAAACAATTCTGTTACAG
rJMFF048C20+ GAAAACAATTCTGTTACAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GAAAACAATTCTGTTACAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG