Previous Contig 010796:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033C05Sequence376002049 (2)746010796 (2)gb:AC097176_17364867e-72Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1576_F01, complete s
JMFF048B11Sequence403002049 (2)331010796 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033C05+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
rJMFF033C05+ GATGCCGGTGTATTTCAAAACTGTTTTCAACGTGAACTTGAAGCAAGCGGCTTGGTTTAG
                      ____________________________________________________________
consensus GATGCCGGTGTATTTCAAAACTGTTTTCAACGTGAACTTGAAGCAAGCGGCTTGGTTTAG
 
. : . : . : . : . : . :
rJMFF033C05+ TGCTATACCATGGGCAACGATGGCAGTGTCAGGCTATGTTGCAGGGGCTGTGTCTGATTC
                      ____________________________________________________________
consensus TGCTATACCATGGGCAACGATGGCAGTGTCAGGCTATGTTGCAGGGGCTGTGTCTGATTC
 
. : . : . : . : . : . :
rJMFF033C05+ CTTAATCAAAGCAGGATATTCCATAACATTTGTCCGGAAAGTCATGCAGTCTATTGGCTT
                      ____________________________________________________________
consensus CTTAATCAAAGCAGGATATTCCATAACATTTGTCCGGAAAGTCATGCAGTCTATTGGCTT
 
. : . : . : . : . : . :
rJMFF033C05+ CATTGGCCCCGGATTGTCATTGCTCTGTCTGAACTTCGCCAAGACACCCGAGGTTGCAGC
                      ____________________________________________________________
consensus CATTGGCCCCGGATTGTCATTGCTCTGTCTGAACTTCGCCAAGACACCCGAGGTTGCAGC
 
. : . : . : . : . : . :
rJMFF033C05+ CATAATGATTACAATAGCCCTGAGCTTTAGCTCTTTCAGTCAGGCTGGCTTTTTACTAAA
                      ____________________________________________________________
consensus CATAATGATTACAATAGCCCTGAGCTTTAGCTCTTTCAGTCAGGCTGGCTTTTTACTAAA
 
. : . : . : . : . : . :
rJMFF033C05+ TATGCAAGATATCGCACCTCAATATGCAGGATTCCTCCACGGCATATCAAATTCGTGTGG
                      ____________________________________________________________
consensus TATGCAAGATATCGCACCTCAATATGCAGGATTCCTCCACGGCATATCAAATTCGTGTGG
 
. : . : . : . : . : . :
rJMFF033C05+ AACAATGGCCGCCATAGTGAGCACGATTGGAACTGGGTTCTTTGTACAGTGGCTGGGATC
                      ____________________________________________________________
consensus AACAATGGCCGCCATAGTGAGCACGATTGGAACTGGGTTCTTTGTACAGTGGCTGGGATC
 
. : . : . : . : . : . :
rJMFF033C05+ TTTCCAAGCATTTTTGACACTCACAGCTTGTCTCTACTTCATCTCTGCCATTTTCTGGAA
                      ____________________________________________________________
consensus TTTCCAAGCATTTTTGACACTCACAGCTTGTCTCTACTTCATCTCTGCCATTTTCTGGAA
 
. : . : . : . : . : . :
rJMFF033C05+ TCTTTTTGCCACTGGTGAAAGGGTTTTCTAAACTCAAACTCCATTCAGTAGCCTAGCTGA
rJMFF048B11+ AAACTCAAACTCCATTCAGTAGCCTAGCTGA
                      ____________________________________________________________
consensus TCTTTTTGCCACTGGTGAAAGGGTTTTCTAAACTCAAACTCCATTCAGTAGCCTAGCTGA
 
. : . : . : . : . : . :
rJMFF033C05+ AGATGAAAAAATACAGAAACAGTGGGGAGAGGAAACCTCATTGCAATGCTTCATTCTTTA
rJMFF048B11+ AGATGAAAAAATACAGAAACAGTGGGGAGAGGAAACCTCATTGCAATGCTTCATTCTTTA
                      ____________________________________________________________
consensus AGATGAAAAAATACAGAAACAGTGGGGAGAGGAAACCTCATTGCAATGCTTCATTCTTTA
 
. : . : . : . : . : . :
rJMFF033C05+ GTGTCGTTTATATTCTAACATATGTCTGGGGAAGGATCAGACTTAGGATTGTATAGATAT
rJMFF048B11+ GTGTCGTTTATATTCTAACATATGTCTGGGGAAGGATCAGACTTAGGATTGTATAGATAT
                      ____________________________________________________________
consensus GTGTCGTTTATATTCTAACATATGTCTGGGGAAGGATCAGACTTAGGATTGTATAGATAT
 
. : . : . : . : . : . :
rJMFF033C05+ TTATACATTTATATATGGAGTATATGATATAATATATATATACATACATATGTCGTGTGC
rJMFF048B11+ TTATACATTTATATATGGAGTATATGATATAATATATATATACATACATATGTCGTGTGC
                      ____________________________________________________________
consensus TTATACATTTATATATGGAGTATATGATATAATATATATATACATACATATGTCGTGTGC
 
. : . : . : . : . : . :
rJMFF033C05+ ATCAAAGAAAAGAAGGAGAAGAAT
rJMFF048B11+ ATCAAAGAAAAGAAGGAGAAGAATAACATTCTTTTTGGTTTCTTGTTGATTCTTTGATCC
                      ____________________________________________________________
consensus ATCAAAGAAAAGAAGGAGAAGAATAACATTCTTTTTGGTTTCTTGTTGATTCTTTGATCC
 
. : . : . : . : . : . :
rJMFF048B11+ AATTTGATCTTTGTCATTTCAATTAGTCACATTTGAAAAAGCATTTAGGCTTGTTTGTGT
                      ____________________________________________________________
consensus AATTTGATCTTTGTCATTTCAATTAGTCACATTTGAAAAAGCATTTAGGCTTGTTTGTGT