Previous Contig 010793:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003N23Sequence497002045 (14)sp|Q40465|IF4V_TOBAC3e-59Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t664010793 (25)gb:AF079782_17664068e-66Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF006J05Sequence533010793 (25)pir|S52018|S520189e-68translation initiation factor eIF-4A.11 - common tobacco547010414 (7)sp|P41379|IF42_NICPL6e-25Eukaryotic initiation factor 4A-2 (eIF4A-2) (eIF-4A-2).>pir|S22578|S22578 transl
JMFF010P07Sequence554002045 (14)sp|Q40465|IF4V_TOBAC6e-70Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t715010793 (25)gb:AF079782_17664066e-64Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF011P15Sequence577002045 (14)sp|Q40465|IF4V_TOBAC3e-74Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t610010793 (25)gb:AF079782_17664062e-59Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF016K05Sequence599010793 (25)pir|S52018|S520189e-79translation initiation factor eIF-4A.11 - common tobacco
JMFF018F17Sequence554002045 (14)sp|Q40465|IF4V_TOBAC6e-70Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t769010793 (25)gb:AF079782_17664068e-92Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF019H10Sequence575002045 (14)sp|Q40465|IF4V_TOBAC3e-74Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t762010793 (25)gb:AF079782_1766406e-104Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF022C07Sequence502010793 (25)pir|S52018|S520184e-54translation initiation factor eIF-4A.11 - common tobacco385010414 (7)gb:AF079782_17664068e-04Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF022C13Sequence511002045 (14)sp|Q40465|IF4V_TOBAC2e-61Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t610010793 (25)gb:AF079782_17664069e-65Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF025G08Sequence547010793 (25)pir|S52018|S520182e-72translation initiation factor eIF-4A.11 - common tobacco433010414 (7)sp|P41379|IF42_NICPL2e-09Eukaryotic initiation factor 4A-2 (eIF4A-2) (eIF-4A-2).>pir|S22578|S22578 transl
JMFF034E06Sequence366002045 (14)sp|Q40465|IF4V_TOBAC3e-33Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t683010793 (25)gb:AF079782_17664064e-79Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF035N18Sequence541002045 (14)sp|Q40465|IF4V_TOBAC1e-66Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t747010793 (25)gb:AF079782_17664066e-85Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF037K15Sequence592010793 (25)pir|S52018|S520181e-79translation initiation factor eIF-4A.11 - common tobacco299010414 (7)
JMFF040A06Sequence555002045 (14)sp|Q40465|IF4V_TOBAC6e-70Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t759010793 (25)gb:AF079782_17664061e-72Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF040O01Sequence555002045 (14)sp|Q40465|IF4V_TOBAC6e-70Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t724010793 (25)gb:AF079782_17664065e-74Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF043F20Sequence636010793 (25)pir|S52018|S520189e-85translation initiation factor eIF-4A.11 - common tobacco518010414 (7)gb:AF079782_17664069e-35Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF044E24Sequence622010793 (25)pir|S52018|S520183e-83translation initiation factor eIF-4A.11 - common tobacco591010414 (7)gb:AF079782_17664061e-46Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF044L24Sequence637010793 (25)pir|S52018|S520181e-88translation initiation factor eIF-4A.11 - common tobacco563021713gb:AF079782_17664062e-32Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF048A23Sequence614002045 (14)sp|Q40465|IF4V_TOBAC4e-81Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t590010793 (25)gb:AF079782_17664065e-31Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF048B21Sequence352002045 (14)sp|Q40465|IF4V_TOBAC6e-26Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t259010793 (25)
JMFF050L24Sequence594010793 (25)pir|S52018|S520184e-79translation initiation factor eIF-4A.11 - common tobacco329010414 (7)
JMFN041J21Sequence647010793 (25)sp|Q40465|IF4V_TOBACe-118Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t
JMFS038G03Sequence618010793 (25)pir|S52018|S520183e-86translation initiation factor eIF-4A.11 - common tobacco
JMSF022N05Sequence690002045 (14)sp|Q40465|IF4V_TOBAC2e-96Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t754010793 (25)gb:AF079782_17664063e-87Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMSF026H19Sequence657002045 (14)sp|Q40465|IF4V_TOBAC1e-84Eukaryotic initiation factor 4A-11 (eIF4A-11) (eIF-4A-11).>gb:NT4A11_1691238 N.t732010793 (25)gb:AF079782_17664063e-94Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050L24- TCTCACTTTGTGCAAAC
JMFF025G08- GTGCAAAC
JMFF006J05- ACTTTGTGCAAAC
JMFF016K05- CTCTTCTCACTTTGTGCAAAC
JMFF037K15- ACTTTGTGCAAAC
JMFF043F20- ACTTTATGCAAAC
JMFF044E24- TCTCACTTTGTGC-AAC
JMFS038G03- CAAAC
JMFF044L24- TTGTGCAAAC
                      ____________________________________________________________
consensus CTCTTCTCACTTTGTGCAAAC
 
. : . : . : . : . : . :
JMFF050L24- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF025G08- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF006J05- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF016K05- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF037K15- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF043F20- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF044E24- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFS038G03- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
JMFF044L24- TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
                      ____________________________________________________________
consensus TCCGCGGCGTAGATCCGAGGAGTTTCTGAGACCCAGCTGCAAGAAAACCCTAGCTCTTAA
 
. : . : . : . : . : . :
JMFF050L24- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF025G08- TCTCTTCTTCCCTAAATCTCTGGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF022C07- ATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF006J05- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF016K05- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF037K15- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF043F20- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF044E24- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFS038G03- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
JMFF044L24- TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
                      ____________________________________________________________
consensus TCTCTTCTTCCCTAAATCTCTAGATCCTAATTCCATCTTCACTGAAATCAATCATGGCGG
 
. : . : . : . : . : . :
JMFF050L24- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF025G08- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF022C07- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF006J05- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF016K05- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF037K15- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF043F20- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF044E24- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFS038G03- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
JMFF044L24- GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
                      ____________________________________________________________
consensus GAATGGCACCAGAAGGTTCTCAGTTTGATGCGCGTCAGTTTGATGCTAAAATGAATGAGA
 
. : . : . : . : . : . :
JMFF050L24- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF025G08- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF022C07- TCCTGGATACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF006J05- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF016K05- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF037K15- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF043F20- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF044E24- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFS038G03- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
JMFF044L24- TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
                      ____________________________________________________________
consensus TCCTGGAAACTGATGCACAGGAGTTCTTTACATCTTATGATGAGGTATACGACAGCTTCG
 
. : . : . : . : . : . :
JMFF050L24- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF025G08- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF022C07- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF006J05- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF016K05- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF037K15- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF043F20- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF044E24- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFS038G03- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
JMFF044L24- ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
                      ____________________________________________________________
consensus ACTCAATGGGTTTGCAAGAAAACCTTCTCAGGGGCATTTATGCTTATGGTTTTGAGAAGC
 
. : . : . : . : . : . :
JMFF050L24- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF025G08- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF022C07- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF006J05- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF016K05- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF037K15- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF043F20- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF044E24- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFS038G03- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
JMFF044L24- CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
                      ____________________________________________________________
consensus CCTCTGCAATTCAGCAACGTGGTATTGTGCCTTTCTGCAAGGGGCTTGATGTTATTCAAC
 
. : . : . : . : . : . :
JMFF050L24- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF025G08- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF022C07- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF006J05- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF016K05- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF037K15- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF043F20- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF044E24- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFS038G03- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFF044L24- AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
JMFN041J21- CAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
                      ____________________________________________________________
consensus AAGCTCAATCTGGAACTGGAAAGACTGCAACTTTCTGCTCTGGAATCCTCCAACAGCTCG
 
. : . : . : . : . : . :
JMFF050L24- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF025G08- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF022C07- ATTACAGCTTAGTTGAGTGCCAG
JMFF006J05- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF016K05- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF037K15- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF043F20- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF044E24- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFS038G03- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFF044L24- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
JMFN041J21- ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
                      ____________________________________________________________
consensus ATTACAGCTTAGTTGAGTGCCAGGCTTTGGTTCTTGCACCAACACGTGAGCTCGCTCAAC
 
. : . : . : . : . : . :
JMFF050L24- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFF025G08- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGT
JMFF006J05- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGG
JMFF016K05- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFF037K15- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFF043F20- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFF044E24- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFS038G03- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFF044L24- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
JMFN041J21- AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
                      ____________________________________________________________
consensus AAATCGAGAAGGTTATGAGAGCACTTGGCGACTATCTTGGTGTCAAGGTTCATGCTTGTG
 
. : . : . : . : . : . :
JMFF050L24- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCT
JMFF016K05- TGGGANGCACCAGTGTTCGTGAGGATCAGCGCATTCTC
JMFF037K15- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCC
JMFF043F20- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCCAGAGTGGTGTTCATGTCGTGG
JMFF044E24- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCCAGA---GTGTTCATGTCGTGG
JMFS038G03- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTNCAGAGTGGTGTTCATGTCGTGG
JMFF044L24- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCCAGAGTGGTGTTCATGTCGTGG
JMFN041J21- TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCCAGAGTGGTGTTCATGTCGTGG
                      ____________________________________________________________
consensus TGGGAGGCACCAGTGTTCGTGAGGATCAGCGCATTCTCCAGAGTGGTGTTCATGTCGTGG
 
. : . : . : . : . : . :
JMFF043F20- TTGGAA
JMFF044E24- TTGGAACTC
JMFS038G03- TTGGAACTCC
JMFF044L24- TTGGAACTCCGGGACGTGTGTTTG
JMFN041J21- TTGGAACTCCGGGACGTGTGTTTGACATGTTGCGCAGGCAGTCCCTTCGCCCTGATAACA
                      ____________________________________________________________
consensus TTGGAACTCCGGGACGTGTGTTTGACATGTTGCGCAGGCAGTCCCTTCGCCCTGATAACA
 
. : . : . : . : . : . :
JMFN041J21- TCAAGATGTTTGTGTTGGATGAAGCTGATGAAATGCTGTCGAGAGGTTTTAAAGATCAGA
                      ____________________________________________________________
consensus TCAAGATGTTTGTGTTGGATGAAGCTGATGAAATGCTGTCGAGAGGTTTTAAAGATCAGA
 
. : . : . : . : . : . :
JMFN041J21- TCTATGACATTTTCCAATTGCTACCACCAAAGATCCAGGTTGGTGTTTTCTCTGCCACAA
rJMFF019H10+ CTCTGCTACTA
                      ____________________________________________________________
consensus TCTATGACATTTTCCAATTGCTACCACCAAAGATCCAGGTTGGTGTTTTCTCTGCTACTA
 
. : . : . : . : . : . :
JMFN041J21- TGCCACCGGAGGCACTTGAAATCACTAGGAAATTCATGAACAAACCCGTTAGGATTCTTG
rJMFF019H10+ TGCCACCTGAGGCTCTTGAAATCACCCGAAAGTTTATGAACAAGCCTGTTAGGATTCTTG
rJMSF026H19+ GTTAGGATTCTTG
                      ____________________________________________________________
consensus TGCCACCTGAGGCTCTTGAAATCACTCGGAAGTTTATGAACAAGCCTGTTAGGATTCTTG
 
. : . : . : . : . : . :
JMFN041J21- TGAAACGTGATGAGCTTACCT-TGGAAGGTATCAAGCAGTTCTATGTGAATGTCGAGAAA
rJMFF019H10+ TGAAACGTGATGAGCTCAC-TCTGGAAGGTATCAAGCAGTTCTATGTCAATGTCGACAAA
rJMSF026H19+ TGAAACGTGATGAGCTCAC-TCTGGAAGGTATCAAGCAGTTCTATGTCAATGTCGACAAA
rJMFF035N18+ AAACGTGATGAGCTCNCNTNTGGAAGGTATCAAGCAGTTNTATGTCAATGTCGACAAA
rJMFF018F17+ AAACGTGATGAGCTCAC-TCTGGAAGGTATCAAGCAGTTCTATGTCAATGTCGACAAA
rJMSF022N05+ GGTATCAAGCAGTTCTATGTCAATGTCGACAAA
                      ____________________________________________________________
consensus TGAAACGTGATGAGCTCACCTCTGGAAGGTATCAAGCAGTTCTATGTCAATGTCGACAAA
 
. : . : . : . : . : . :
JMFN041J21- GAGGAATGGAAGCTCGAAACACTTTGTGATCTTTACGAGACACTAGCCATTACCCAGAGT
rJMFF019H10+ GAGGAGTGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
rJMSF026H19+ GAGGAGTGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
rJMFF035N18+ GAGGAGTGGAAGCTCGATACACTTCGTGATCTTTATGAGACNCTGGCCATCACCCAGAGT
rJMFF034E06+ TGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
rJMFF018F17+ GAGGAGTGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
rJMSF022N05+ GAGGAGTGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
rJMFF040O01+ TCTTTATGAGACACTGGCCATCACCCAGAGT
rJMFF040A06+ ATGAGACACTGGCCATCACCCAGAGT
                      ____________________________________________________________
consensus GAGGAGTGGAAGCTCGATACACTTTGTGATCTTTATGAGACACTGGCCATCACCCAGAGT
 
. : . : . : . : . : . :
JMFN041J21- GTCATCTTTGTAAACACCAGGCGTAAGGTTGATTGGCTCACTGACAAAATGCG
rJMFF019H10+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMSF026H19+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF035N18+ GTCATCTTTGTTACCACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF034E06+ GTCATCTTTGTTACCACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF018F17+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMSF022N05+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF040O01+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF022C13+ GGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF011P15+ CCGACAAAATGCGTAGCCGT
rJMFF003N23+ CACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF040A06+ GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
rJMFF010P07+ CGAAAGGTTGATTGGCTCACCGACAAAATGNGTAGCCGT
                      ____________________________________________________________
consensus GTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACCGACAAAATGCGTAGCCGT
 
. : . : . : . : . : . :
rJMFF019H10+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMSF026H19+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF035N18+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF034E06+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF018F17+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMSF022N05+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF040O01+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF022C13+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF011P15+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACNCTAGGGACATCATCATG
rJMFF003N23+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF040A06+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
rJMFF010P07+ GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
                      ____________________________________________________________
consensus GATCACACAGTTTCTGCAACTCACGGGGACATGGACCAGAACACTAGGGACATCATCATG
 
. : . : . : . : . : . :
rJMFF019H10+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMSF026H19+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF035N18+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF034E06+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF018F17+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMSF022N05+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF040O01+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF022C13+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF011P15+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF003N23+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF040A06+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
rJMFF010P07+ CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
                      ____________________________________________________________
consensus CGTGAATTTCGGTCTGGTTCTTCCAGAGTGCTTATCACCACTGATCTCTTGGCTCGTGGT
 
. : . : . : . : . : . :
rJMFF019H10+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMSF026H19+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF035N18+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF034E06+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF018F17+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMSF022N05+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF040O01+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF022C13+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF011P15+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF003N23+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF040A06+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF010P07+ ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
rJMFF048A23+ AACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
                      ____________________________________________________________
consensus ATTGATGTCCAACAAGTGTCACTTGTGATCAACTACGACCTCCCTACTCAGCCAGAAAAT
 
. : . : . : . : . : . :
rJMFF019H10+ TACCTCCACCGTATTGGACCAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMSF026H19+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF035N18+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF034E06+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF018F17+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMSF022N05+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF040O01+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF022C13+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF011P15+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF003N23+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF040A06+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF010P07+ TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
rJMFF048A23+ TACCTCCACCGTATTGGACGAAGTGGACGGTTTGGAAGGAAGGGTGTGGCTATCAACTTT
                      ____________________________________________________________
consensus TACCTCCACCGTATTGGACGAAGTGGACGATTTGGAAGGAAGGGTGTGGCTATCAACTTT
 
. : . : . : . : . : . :
rJMFF019H10+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATGCAGAAGTTTTATAATGTTCTAGTC
rJMSF026H19+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF035N18+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF034E06+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF018F17+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMSF022N05+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF040O01+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF022C13+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF011P15+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF003N23+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF040A06+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF010P07+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
rJMFF048A23+ GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
                      ____________________________________________________________
consensus GTCACCAAGGATGACGAAAGGATGCTTTTTGACATACAGAAGTTTTATAATGTTCTAGTC
 
. : . : . : . : . : . :
rJMFF019H10+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMSF026H19+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF035N18+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF034E06+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF018F17+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMSF022N05+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF040O01+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF022C13+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF011P15+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF003N23+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF040A06+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF010P07+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
rJMFF048A23+ GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
                      ____________________________________________________________
consensus GAAGAGTTGCCAGCAAATGTCGCTGATCTCCTGTGATTGGGTCAAAGGCGAGTTGAATTG
 
. : . : . : . : . : . :
rJMFF019H10+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMSF026H19+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF035N18+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF034E06+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF018F17+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMSF022N05+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF040O01+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF022C13+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF011P15+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF003N23+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF040A06+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF048B21+ TTATTTCATAGGCTAGTTGTGTACTGG
rJMFF010P07+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
rJMFF048A23+ TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
                      ____________________________________________________________
consensus TTCCTCAATTGAAGCTCTCTACTATTTCATCACTTATTTCATAGGCTAGTTGTGTACTGG
 
. : . : . : . : . : . :
rJMFF019H10+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMSF026H19+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF035N18+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF034E06+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF018F17+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMSF022N05+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF040O01+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF022C13+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF011P15+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF003N23+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF040A06+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF048B21+ ACTTGGTGTTGGGAAATTTTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF010P07+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
rJMFF048A23+ ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
                      ____________________________________________________________
consensus ACTTGGTGTTGGGAAATTCTGGCCTTTGTATTTCGATAGGGGGTTGCAGTTTCCCAATTT
 
. : . : . : . : . : . :
rJMFF019H10+ GGTCACAAGTCCAAATCTACTACTGGAAATTT
rJMSF026H19+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF035N18+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF034E06+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF018F17+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMSF022N05+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF040O01+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF022C13+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF011P15+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF003N23+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF040A06+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF048B21+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF010P07+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
rJMFF048A23+ GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
                      ____________________________________________________________
consensus GGTCACAAGTCCAAATCTACTACTGGAAATTTTGTTGGTTTTGTCTTTGTACTGTAAGTT
 
. : . : . : . : . : . :
rJMFF035N18+ TCAGAAAAGAACAAAAAAAACCCAGGATT
rJMFF034E06+ TCAGAAAAGAACAAAAAAAACCCAGGATT
rJMFF018F17+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTT
rJMSF022N05+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTT
rJMFF040O01+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
rJMFF022C13+ TCAGAAAAGAACAAAAAAAACCCAGGATT
rJMFF011P15+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTAT
rJMFF003N23+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
rJMFF040A06+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
rJMFF048B21+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
rJMFF010P07+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
rJMFF048A23+ TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
                      ____________________________________________________________
consensus TCAGAAAAGAACAAAAAAAACCCAGGATTTGAATGTTGTTTGAGGTTTATTTATTTTGTT
 
. : . : . : . : . : . :
rJMFF040O01+ TAAACACTTATCTTTATTTCTGTTTAT
rJMFF003N23+ TAAACACTTATCTTTATT
rJMFF040A06+ TAAACACTTATCTTTATTTCTGTTTATTGAGGGCATTTGTTTTCTCAGTGTCTAAAGTTT
rJMFF048B21+ TAAACACTTATCTTTATTTCTGTTTATTGAGGGCATTTGTTTT
rJMFF010P07+ TAAACACTTATCTTTATTTCTGTTTATTGAGGGCATTTGTTTTCTCAGTGTCTAAAGTTT
rJMFF048A23+ TAAACACTTATCTTTATTTCTGTTTATTGAGGGCATTTGTTTTCTCAGTGTCTAAAGTTT
                      ____________________________________________________________
consensus TAAACACTTATCTTTATTTCTGTTTATTGAGGGCATTTGTTTTCTCAGTGTCTAAAGTTT
 
. : . : . : . : . : . :
rJMFF040A06+ TT
rJMFF010P07+ TT
rJMFF048A23+ TTTCTTTGAAGAGAGATTTACCACAAGTTGAGGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTTCTTTGAAGAGAGATTTACCACAAGTTGAGGAAAAAAAAAAAAAAAACTCTCCAGGGT