Previous Contig 010791:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048A12Sequence409002043 (4)gb:BT011628_16411501e-04Arabidopsis thaliana At2g44410 mRNA, complete cds.>gb:BT012267_1641473 Arabidops238010791 (3)
JMSF015K22Sequence260010791 (3)440010791 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF015K22- AAATGAAGATTCTGATGCTGTTGTACAATTGGGAAA
rJMSF015K22+ AAATGAAGATTCTGATGCTGTTGTACAATTGGGAAA
                      ____________________________________________________________
consensus AAATGAAGATTCTGATGCTGTTGTACAATTGGGAAA
 
. : . : . : . : . : . :
JMSF015K22- CCTGATACCCACTACAAGTGGTGAAAGGGATCAGCCTTTGCCACGGACTCCATCTTATAG
rJMSF015K22+ CCTGATACCCACTACAAGTGGTGAAAGGGATCAGCCTTTGCCACGGACTCCATCTTATAG
                      ____________________________________________________________
consensus CCTGATACCCACTACAAGTGGTGAAAGGGATCAGCCTTTGCCACGGACTCCATCTTATAG
 
. : . : . : . : . : . :
JMSF015K22- GAGAAGATTTAGTTTGTTGAGGTTTTCTGACACTAATAATGAAGTTTCCCGCGAAACTAG
rJMSF015K22+ GAGAAGATTTAGTTTGTTGAGGTTTTCTGACACTAATAATGAAGTTTCCCGCGAAACTAG
                      ____________________________________________________________
consensus GAGAAGATTTAGTTTGTTGAGGTTTTCTGACACTAATAATGAAGTTTCCCGCGAAACTAG
 
. : . : . : . : . : . :
JMSF015K22- AAGGAGAAGATTGAACTAATGACTTCCAACTACTAATAAGCTTTAGAAGCATAGGCAGAA
rJMSF015K22+ AAGGAGAAGATTGAACTAATGACTTCCAACTACTAATAAGCTTTAGAAGCATAGGCAGAA
                      ____________________________________________________________
consensus AAGGAGAAGATTGAACTAATGACTTCCAACTACTAATAAGCTTTAGAAGCATAGGCAGAA
 
. : . : . : . : . : . :
JMSF015K22- CACATTCAGCTACTGCCTGATTTCACGATTGGCCAATATGGAGG
rJMSF015K22+ CACATTCAGCTACTGCCTGATTTCACGATTGGCCAATATGGAGGAACTTGTGATACACGG
                      ____________________________________________________________
consensus CACATTCAGCTACTGCCTGATTTCACGATTGGCCAATATGGAGGAACTTGTGATACACGG
 
. : . : . : . : . : . :
rJMSF015K22+ TTTCATCAACTAGAGTTAGCCACATGGAGTGTAACTCGATTGTATACTAGGAAGTAGGTT
rJMFF048A12+ TCATCAACTAGAGTTAGCCACATGGAGTGTAACTCGATTGTATACTAGGAAGTAGGTT
                      ____________________________________________________________
consensus TTTCATCAACTAGAGTTAGCCACATGGAGTGTAACTCGATTGTATACTAGGAAGTAGGTT
 
. : . : . : . : . : . :
rJMSF015K22+ ATCTTTTCCTTTGGTTAAGCATCTTTATTGGCTTAAAGCTTGTTGCTGGGCTTTACATGT
rJMFF048A12+ ATCTTTTCCTTTGGTTAAGCATCTTTATTGGCTTAAAGCTTGTTGCTGGGCTTTACATGT
                      ____________________________________________________________
consensus ATCTTTTCCTTTGGTTAAGCATCTTTATTGGCTTAAAGCTTGTTGCTGGGCTTTACATGT
 
. : . : . : . : . : . :
rJMSF015K22+ TTATGTGATGGGGTCAATGAATGTTATGAATTTTTCAAGGCTAC
rJMFF048A12+ TTATGTGATGGGGTCAATGAATGTTATGAATTTTTCAAGGCTACTTCCAACTTTCCTACT
                      ____________________________________________________________
consensus TTATGTGATGGGGTCAATGAATGTTATGAATTTTTCAAGGCTACTTCCAACTTTCCTACT
 
. : . : . : . : . : . :
rJMFF048A12+ GTCATTAAAATGAAGATTCATTCTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGGC
                      ____________________________________________________________
consensus GTCATTAAAATGAAGATTCATTCTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGGC