Previous Contig 010787:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007A07Sequence558000358 (6)gb:AY087396_15724272e-46Arabidopsis thaliana clone 34936 mRNA, complete sequence.709010787 (6)pir|T02292|T022923e-50hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop
JMFF012F03Sequence443000358 (6)gb:AY087396_15724274e-30Arabidopsis thaliana clone 34936 mRNA, complete sequence.777010787 (6)pir|T02292|T022922e-64hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop
JMFF036O12Sequence530000358 (6)gb:AY087396_15724271e-52Arabidopsis thaliana clone 34936 mRNA, complete sequence.710010787 (6)pir|T02292|T022921e-51hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop
JMFF046P03Sequence645000358 (6)gb:AY087396_15724273e-60Arabidopsis thaliana clone 34936 mRNA, complete sequence.514010787 (6)pir|T02292|T022921e-18hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop
JMFF047P21Sequence632000358 (6)gb:AY087396_15724278e-57Arabidopsis thaliana clone 34936 mRNA, complete sequence.612010787 (6)pir|T02292|T022922e-28hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop
JMSF002D07Sequence256000358 (6)gb:AY087396_15724271e-11Arabidopsis thaliana clone 34936 mRNA, complete sequence.721010787 (6)pir|T02292|T022921e-55hypothetical protein T13D8.29 - Arabidopsis thaliana>gb:AE005173_893720 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012F03+ TTCTCTGCTCATTGG
                      ____________________________________________________________
consensus TTCTCTGCTCATTGG
 
. : . : . : . : . : . :
rJMFF036O12+ CAAAGCA
rJMSF002D07+ TTCTACCAAAACTCATTGAGGCATACCACAATATCAAAGCA
rJMFF012F03+ TGTCCTCCTTGCCGTGCTTTTCTACCAAAACTCATTGAGGCATACCACAATATCAAAGCA
rJMFF007A07+ CAAAGCA
                      ____________________________________________________________
consensus TGTCCTCCTTGCCGTGCTTTTCTACCAAAACTCATTGAGGCATACCACAATATCAAAGCA
 
. : . : . : . : . : . :
rJMFF036O12+ AAGGATGATGCATTTGAAGTGATTTTCATCTCCAGTGACAGAGATCAGTCCTCCTTTGAT
rJMSF002D07+ AAGGATGATGCATTTGAAGTGATTTTCATCTCCAGTGACAGAGATCAGTCCTCCTTTGAT
rJMFF012F03+ AAGGATGATGCATTTGAAGTGATTTTCATCTCCAGTGACAGAGATCAGTCCTCCTTTGAT
rJMFF007A07+ AAGGATGATGCATTTGAAGTGATTTTCATCTCCAGTGACAGAGATCAGTCCTCCTTTGAT
                      ____________________________________________________________
consensus AAGGATGATGCATTTGAAGTGATTTTCATCTCCAGTGACAGAGATCAGTCCTCCTTTGAT
 
. : . : . : . : . : . :
rJMFF036O12+ GAATTCTTTTCTAAGATGCCATGGCTGGCTATTCCTTATGGCGATGATAGGAAGGGATCT
rJMSF002D07+ GAATTCTTTTCTAAGATGCCATGGCTGGCTATTCCTTATGGCGATGATAGGAAGGGATCT
rJMFF012F03+ GAATTCTTTTCTAAGATGCCATGGCTGGCTATTCCTTATGGCGATGATAGGAAGGGATCT
rJMFF007A07+ GAATTCTTTTCTAAGATGCCATGGCTGGCTATTCTTTATGGCGATGATAGGAAGGGATCT
rJMFF047P21+ GATAGGAAGGGATCT
                      ____________________________________________________________
consensus GAATTCTTTTCTAAGATGCCATGGCTGGCTATTCCTTATGGCGATGATAGGAAGGGATCT
 
. : . : . : . : . : . :
rJMFF036O12+ TTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATTGGAAGAACAGGC
rJMSF002D07+ TTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATTGGAAGAACAGGC
rJMFF012F03+ TTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATTGGAAGAACAGGC
rJMFF007A07+ TTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATTGGAAGAACAGGC
rJMFF047P21+ NTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATNGGAAGAACAGGC
                      ____________________________________________________________
consensus TTGAGTCGCCTATTCAAAGTTCGTGGAATCCCAATGTTAGTTGCCATTGGAAGAACAGGC
 
. : . : . : . : . : . :
rJMFF036O12+ CGAACTCTCACCACTGAAGCTAGAAATTTGGTGATGAGTCATGGTGCTGATGCTTATCCC
rJMSF002D07+ CGAACTCTCACCACTGAAGCTAGAAATTTGGTGATGAGTCATGGTGCTGATGCTTATCCC
rJMFF012F03+ CGAACTCTCACCACTGAAGCTAGAAATTTGGTGATGAGTCATGGTGCTGATGCTTATCCC
rJMFF007A07+ CGAACTCTCACCACTGAAGCTAGAAATTTGGTGATGAGTCATGGTGCTGATGCTTATCCC
rJMFF046P03+ AAGCTAGAAATTGGGTGATGAGTCATGGTGCTGATGCTATCCCC
rJMFF047P21+ CGAACTCTCACCACTGAAGCTAGAAATTTGGTGNTGAGTCATGGTGCTGATGCTTATCCC
                      ____________________________________________________________
consensus CGAACTCTCACCACTGAAGCTAGAAATTTGGTGATGAGTCATGGTGCTGATGCTTATCCC
 
. : . : . : . : . : . :
rJMFF036O12+ TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGGGGTGG
rJMSF002D07+ TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGGGGTGG
rJMFF012F03+ TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGTGGTGG
rJMFF007A07+ TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGTGGTGG
rJMFF046P03+ TTCACGGAAGAGCGTTGNAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGGGGTGG
rJMFF047P21+ TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGGGGTGG
                      ____________________________________________________________
consensus TTCACGGAAGAGCGTTTGAAGGAGCTTGAAGCTGAATATGAAGAGATGGCAAAGGGGTGG
 
. : . : . : . : . : . :
rJMFF036O12+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGACGCCAG
rJMSF002D07+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGACGCCAG
rJMFF012F03+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGACGCCAG
rJMFF007A07+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGACGCCAG
rJMFF046P03+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGAC-CCAG
rJMFF047P21+ CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGAC-CCAG
                      ____________________________________________________________
consensus CCTGAGAAAATGAATCATGCCCTTCATGAAGAACATGAGCTTTTGCTTACAAGACGCCAG
 
. : . : . : . : . : . :
rJMFF036O12+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
rJMSF002D07+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
rJMFF012F03+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
rJMFF007A07+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
rJMFF046P03+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
rJMFF047P21+ CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
                      ____________________________________________________________
consensus CATTATACTTGTGATGGATGCAATGAAGGGGGACAAGGTTGGTCATTCTATTGTGATGAT
 
. : . : . : . : . : . :
rJMFF036O12+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
rJMSF002D07+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
rJMFF012F03+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
rJMFF007A07+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
rJMFF046P03+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
rJMFF047P21+ TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
                      ____________________________________________________________
consensus TGTGACTTTGACCTCCACCCAAAATGTGCTTTGGAAGAAAAAAAGGAAGAGCCCACAGAA
 
. : . : . : . : . : . :
rJMFF036O12+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
rJMSF002D07+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
rJMFF012F03+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
rJMFF007A07+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
rJMFF046P03+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
rJMFF047P21+ GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
                      ____________________________________________________________
consensus GAGGAGAGCCAGAAAGATGATGAGAAAACAAAGGAGGGCTGGGTTTGTGATGGTGAAGTT
 
. : . : . : . : . : . :
rJMFF036O12+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
rJMSF002D07+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
rJMFF012F03+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
rJMFF007A07+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
rJMFF046P03+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
rJMFF047P21+ TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
                      ____________________________________________________________
consensus TGTAAGAAAGCTTAAGAAGTTTTTCGAGGTCTGTGGATTGTTATTATTGCCATATTGCAT
 
. : . : . : . : . : . :
rJMFF036O12+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
rJMSF002D07+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTACCGGAGTACTAG
rJMFF012F03+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
rJMFF007A07+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
rJMFF046P03+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
rJMFF047P21+ ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
                      ____________________________________________________________
consensus ATGCTGAGCTGTTTAATTCTTATATCCATCATATACTCATATTTATTA-CGGAGTACTAG
 
. : . : . : . : . : . :
rJMFF036O12+ GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAA
rJMSF002D07+ GTTAATGCCTGTATCAACCC
rJMFF012F03+ GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAA
rJMFF007A07+ GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAA
rJMFF046P03+ GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAATAAAACTGG
rJMFF047P21+ GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAATAAAACTGGTTTTCCG
                      ____________________________________________________________
consensus GTTAATG-CTGTATCAACCCTTACTTTGTGTGATGTATCCCCAATAAAACTGGTTTTCCG