Previous Contig 010781:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040N04Sequence110014893561010781 (6)gb:AF011555_17611743e-28Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.
JMFF047N23Sequence605010781 (6)gb:AF011555_17611741e-77Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.592010781 (6)gb:AF011555_17611741e-15Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.
JMSF009H09Sequence621010781 (6)gb:AF011555_17611748e-51Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.
JMSF024K05Sequence593010781 (6)gb:AF011555_17611745e-69Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.761010781 (6)gb:AF011555_17611745e-33Lycopersicon esculentum jasmonic acid 2 (LEJA2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047N23- CTGAGGAAAAAAAGAAGAGAGA
                      ____________________________________________________________
consensus CTGAGGAAAAAAAGAAGAGAGA
 
. : . : . : . : . : . :
JMFF047N23- ATTGGGAAAAAAAACATTTAAAAACATTTTCCCGATTTCTCAGTGGCTTAGCTCTCACTT
                      ____________________________________________________________
consensus ATTGGGAAAAAAAACATTTAAAAACATTTTCCCGATTTCTCAGTGGCTTAGCTCTCACTT
 
. : . : . : . : . : . :
JMFF047N23- CCAGCTCTCTGTTTGAAAGXXXXXXXXXXXXXXXXXXXXXXGCTTATTTTTTTCTGAAAA
JMSF024K05- GCTTATTTTTTTCTGAAAA
                      ____________________________________________________________
consensus CCAGCTCTCTGTTTGAAAGNNNNNNNNNNNNNNNNNNNNNNGCTTATTTTTTTCTGAAAA
 
. : . : . : . : . : . :
JMFF047N23- ATGGGTGTCAAAGATATGGACCCGCTTTCGCAGCTGAGTTTGCCGCCGGGTTTCCGGTTT
JMSF024K05- ANGGGNGTCAAANATATGGACCCGCTTTCNCAGCTGAGTTTGCCNCCGGGTTTCCGGTTT
                      ____________________________________________________________
consensus ATGGGTGTCAAAGATATGGACCCGCTTTCGCAGCTGAGTTTGCCGCCGGGTTTCCGGTTT
 
. : . : . : . : . : . :
JMFF047N23- TACCCGACAGACGAGGAGCTTTTGGTGCAGTACTTGTGTAGAAAGGTGGCTGGGCATGAC
JMSF024K05- TACCCGACAGACGAGGAGCTTTTGGNGCAGTACTTGTGTANAAAGGNGGCTGGGCATGAC
                      ____________________________________________________________
consensus TACCCGACAGACGAGGAGCTTTTGGTGCAGTACTTGTGTAGAAAGGTGGCTGGGCATGAC
 
. : . : . : . : . : . :
JMFF047N23- TTTTCTCTGCAGATCATCGGAGACATCGACTTGTACAAGTTTGATCCGTGGGATCTTCCT
JMSF024K05- TTTTCTCTGCANATCATCGGANACATCGACTTGTACAAGTTTGATCCGNGGGATCTTCCT
                      ____________________________________________________________
consensus TTTTCTCTGCAGATCATCGGAGACATCGACTTGTACAAGTTTGATCCGTGGGATCTTCCT
 
. : . : . : . : . : . :
JMFF047N23- AGCAGGGCGAATTTCGGGGAAAAAGAATGGTATTTTTTCAGCCCACGAGATCGGAAATAT
JMSF024K05- AGCAGGGCGAATTTCGGGGAAAAANAATGGTATTTTTTCAGCCCACGANATCGGAAATAT
                      ____________________________________________________________
consensus AGCAGGGCGAATTTCGGGGAAAAAGAATGGTATTTTTTCAGCCCACGAGATCGGAAATAT
 
. : . : . : . : . : . :
JMFF047N23- CCGAATGGGTCGAGGCCGAATAGAGTCGCCGGTTCCGGCTACTGGAAAGCCACCGGAACC
JMSF024K05- CCNAATGGGTCNAGGCCNAANANAGTCNCCGGTTCCGGCTACNGGAAAGCCNCCGGAACC
rJMSF009H09+ AAGCCACCGGAACC
                      ____________________________________________________________
consensus CCGAATGGGTCGAGGCCGAATAGAGTCGCCGGTTCCGGCTACTGGAAAGCCACCGGAACC
 
. : . : . : . : . : . :
JMFF047N23- GACAAGATAATAACCACCCAAGGACGGAAAGTTGGGATCAAGAAAGCCCTTGTTTTTTAC
JMSF024K05- GACAAGATAATAACCNCCCAAGGACGGAAAGTTGGGATCAAGAAAGCCCTTGTTTTTTAC
rJMSF009H09+ GACAAGATAATAACCACCCAAGGACGGAAAGTTGGGATCAAGAAAGCCCTTGTTTTTTAC
                      ____________________________________________________________
consensus GACAAGATAATAACCACCCAAGGACGGAAAGTTGGGATCAAGAAAGCCCTTGTTTTTTAC
 
. : . : . : . : . : . :
JMFF047N23- GTGGGTAAAGCACCCAAAGGAACAAAGACTAATTGGATTATGCATGAATATAGGCTTTCT
JMSF024K05- GNGGGTAAAGCNCCCAAAGGAACAAAGACTAATTGGATTATGCATGAATATAGGCTTTCT
rJMSF009H09+ GTGGGTAAAGCACCCAAAGGAACAAAGACTAATTGGATTATGCATGAATATAGGCTTTCT
rJMFF040N04+ GGATTATGCATGAATATAGGCTTTCT
                      ____________________________________________________________
consensus GTGGGTAAAGCACCCAAAGGAACAAAGACTAATTGGATTATGCATGAATATAGGCTTTCT
 
. : . : . : . : . : . :
JMFF047N23- GAAGCACCCAGGAAAA-CCGGAAGTGCAAGGCTTGATGAATGGG
JMSF024K05- GAAGCACCCAGGAAAA-CCGGAAGTGCAAGGCTTGATGAATGGGTGCTATGTCGGA
rJMSF009H09+ GAAGCACCCAGGAAAA-CCGGAAGTGCAAGGCTTGATGAATGGGTGCTATGTCGGATTTA
rJMFF040N04+ GAAGCACCCAGGAAAACCCGGAAGTGCAAGGCTTGATGAATGGGTGCTATGTCGGATTTA
rJMSF024K05+ AGCACCCAGGAAAA-CCGGAAGTGCAAGGCTTGATGAATGGGTGCTATGTCGGATTTA
                      ____________________________________________________________
consensus GAAGCACCCAGGAAAA-CCGGAAGTGCAAGGCTTGATGAATGGGTGCTATGTCGGATTTA
 
. : . : . : . : . : . :
rJMSF009H09+ CAAGAAGAATTCTTCAAGTGCGGCGGCGGCGGCTCAGAAGCCGGTTTCTGGTGTTCAGAG
rJMFF040N04+ CAAGAAGAATTCTTCAAGTGCGGCGGCGGCGGCTCAGAAGCCGGTTTCTGGTGTTCAGAG
rJMSF024K05+ CAAGAAGAATTCTTCAAGTGCGGCGGCGGCGGCTCAGAAGCCGGTTTCTGGTGTTCAGAG
                      ____________________________________________________________
consensus CAAGAAGAATTCTTCAAGTGCGGCGGCGGCGGCTCAGAAGCCGGTTTCTGGTGTTCAGAG
 
. : . : . : . : . : . :
rJMSF009H09+ CAAAGATTACAGCCACGGCTCCTCGTCGTCGTCTTCATCTCAGTTCGACGACATGCTGGA
rJMFF040N04+ CAAAGATTACAGCCACGGCTCCTCGTCGTCGTCTTCATCTCAGTTCGACGACATGCTGGA
rJMSF024K05+ CAAAGATTACAGCCACGGCTCCTCGTCGTCGTCTTCATCTCAGTTCGACGACATGCTGGA
                      ____________________________________________________________
consensus CAAAGATTACAGCCACGGCTCCTCGTCGTCGTCTTCATCTCAGTTCGACGACATGCTGGA
 
. : . : . : . : . : . :
rJMSF009H09+ ATCTTTCCCGGAAATTAACGATCAATACTTTACCTTACCCAGAATCAACTCGTTAAAGAA
rJMFF040N04+ ATCTTTCCCGGAAATTAACGATCAATACTTTACCTTACCCAGAATCAACTCGTTAAAGAA
rJMSF024K05+ ATCTTTCCCGGAAATTAACGATCAATACTTTACCTTACCCAGAATCAACTCGTTAAAGAA
rJMFF047N23+ CGGAAATTAACGATCAATACTTTACCTTACCCAGAATCAACTCGTTAAAGAA
                      ____________________________________________________________
consensus ATCTTTCCCGGAAATTAACGATCAATACTTTACCTTACCCAGAATCAACTCGTTAAAGAA
 
. : . : . : . : . : . :
rJMSF009H09+ TCTTAATCTTCAACAAGACGACAAGTCAAGTATCCAACGTTTGAGCTCCGGGAGTTTTGA
rJMFF040N04+ TCTTAATCTTCAACAAGACGACAAGTCAAGTATCCAACGTTTGAGCTCCCGGAGTTTTGA
rJMSF024K05+ TCTTAATCTTCAACAAGACGACAAGTCAAGTATCCAACGTTTGAGCTCCGGGAGTTTTGA
rJMFF047N23+ TCTTAATCTTCAACAAGACGACAAGTCAAGTATCCAACGTTTGAGCTCCCGGAGTTTTGA
                      ____________________________________________________________
consensus TCTTAATCTTCAACAAGACGACAAGTCAAGTATCCAACGTTTGAGCTCCGGGAGTTTTGA
 
. : . : . : . : . : . :
rJMSF009H09+ CTGGGCCACCTTAGCCTCCATACCTGAATTGGGGCCGGGTAATCAAATTCCCCAATCGGG
rJMFF040N04+ CTGGGCCACCTTAGCCTCCATACCTGAATTGGGGCCGGGTAATCAAATTCCCCAATCGGG
rJMSF024K05+ CTGGGCCACCTTAGCCTCCATACCTGAATTGGGGCCGGGTAATCAAATTCCCCAATCGGG
rJMFF047N23+ CTGGGCCACCTTAGCCTCCATACCTGAATTGGGGCCGGGTAATCAAATTCCCCAATCGGG
                      ____________________________________________________________
consensus CTGGGCCACCTTAGCCTCCATACCTGAATTGGGGCCGGGTAATCAAATTCCCCAATCGGG
 
. : . : . : . : . : . :
rJMSF009H09+ TCATCTGAACCACGCCAACCCGGCCGATATTTATGGCCATTCAATGGCGGCATTGAGTTT
rJMFF040N04+ TCATCTGAACCACGCCAACCCGGCCGATATTTATGGCCATTCAATGGCGGCATTGAGTTT
rJMSF024K05+ TCATCTGAACCACGCCAACCCGGCCGATATTTATGGCCATTCAATGGCGGCATTGAGTTT
rJMFF047N23+ TCATCTGAACCACGCCAACCCGGCCGATATTTATGGCCATTCAATGGCGGCATTGAGTTT
                      ____________________________________________________________
consensus TCATCTGAACCACGCCAACCCGGCCGATATTTATGGCCATTCAATGGCGGCATTGAGTTT
 
. : . : . : . : . : . :
rJMSF009H09+ TCCCGTAGACGATGAAGCGCAGAGCGGAATGAGGAGTAGTCAGCGGGTTGAGAATAATT
rJMFF040N04+ TCCCGTAGACGATGAAGCGCAGAGCGGAATGAGGAGTAGTCAGCGGGTTGAGAATAATTC
rJMSF024K05+ TCCCGTAGACGATGAAGCGCAGAGCGGAATGAGGAGTAGTCAGCGGGTTGAGAATAATTC
rJMFF047N23+ TCCCGTAGACGATGAAGCGCAGAGCGGAATGAGGAGTAGTCAGCGGGTTGAGAATAATTC
                      ____________________________________________________________
consensus TCCCGTAGACGATGAAGCGCAGAGCGGAATGAGGAGTAGTCAGCGGGTTGAGAATAATTC
 
. : . : . : . : . : . :
rJMFF040N04+ GGGTATCTACCAGCCGCAAAACCCGAACCCGTTCACACACAACTTCTCGAATTT
rJMSF024K05+ GGGTATCTACCAGCCGCAAAACCCGAACCCGTTCACACACAACTTCTCGAATTTACTTGA
rJMFF047N23+ GGGTATCTACCAGCCGCAAAACCCGAACCCGTTCACACACAACTTCTCGAATTTACTTGA
                      ____________________________________________________________
consensus GGGTATCTACCAGCCGCAAAACCCGAACCCGTTCACACACAACTTCTCGAATTTACTTGA
 
. : . : . : . : . : . :
rJMSF024K05+ CCCGTTTGGAATCCGATACCCCAACCAACCGGGTAGCTTAGCGTTCAGGCAGTAACAAAA
rJMFF047N23+ CCCGTTTGGAATCCGATACCCCAACCAACCGGGTAGCTTAGCGTTCAGGCAGTAACAAAA
                      ____________________________________________________________
consensus CCCGTTTGGAATCCGATACCCCAACCAACCGGGTAGCTTAGCGTTCAGGCAGTAACAAAA
 
. : . : . : . : . : . :
rJMSF024K05+ TATTAGGGTTAAATTTAGAAATCCAGAAGATTCAGGGGCATGTGACTCCAATTTATTCTC
rJMFF047N23+ TATTAGGGTTAAATTTAGAAATCCAGAAGATTCAGGGGCATGTGACTCCAATTTATTCTC
                      ____________________________________________________________
consensus TATTAGGGTTAAATTTAGAAATCCAGAAGATTCAGGGGCATGTGACTCCAATTTATTCTC
 
. : . : . : . : . : . :
rJMSF024K05+ TTCGCCTAAATATGTTTGTTCATTTCACTTACTTGCCCCGAAAGATTGTTCATTTCACTT
rJMFF047N23+ TTCGCCTAAATATGTTTGTTCATTTCACTTACTTGCCCCGAAAGATTGTTCATTTCACTT
                      ____________________________________________________________
consensus TTCGCCTAAATATGTTTGTTCATTTCACTTACTTGCCCCGAAAGATTGTTCATTTCACTT
 
. : . : . : . : . : . :
rJMSF024K05+ ACTTGCCCCGAAAGATTGTTCATTTCACTTACT
rJMFF047N23+ ACTTGCCCCGAAAGATTGTTCATTTCACTTACTTGGAACTATTATTAGAGGAGAAACTTT
                      ____________________________________________________________
consensus ACTTGCCCCGAAAGATTGTTCATTTCACTTACTTGGAACTATTATTAGAGGAGAAACTTT