Previous Contig 010778:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047N16Sequence611010778 (2)gb:AF061282_17651931e-17Sorghum bicolor 22 kDa kafirin cluster.544010778 (2)gb:AF061282_17651933e-18Sorghum bicolor 22 kDa kafirin cluster.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047N16- ACATTAAAGAAACCAACAAAAATCTTTATCATTT
                      ____________________________________________________________
consensus ACATTAAAGAAACCAACAAAAATCTTTATCATTT
 
. : . : . : . : . : . :
JMFF047N16- CTCTTGATAACATTTTTTTTCTATATCATACCAATCCTTTGAAATGGGAAACACCCAGAC
                      ____________________________________________________________
consensus CTCTTGATAACATTTTTTTTCTATATCATACCAATCCTTTGAAATGGGAAACACCCAGAC
 
. : . : . : . : . : . :
JMFF047N16- AACCCCATCAGCCCCATCCTCCGCCGCCAATCCCGCCACCGGAGAGTACAATGCTGCGTC
                      ____________________________________________________________
consensus AACCCCATCAGCCCCATCCTCCGCCGCCAATCCCGCCACCGGAGAGTACAATGCTGCGTC
 
. : . : . : . : . : . :
JMFF047N16- CATCCCTCCCGGCGGCGTTATCACCATCCTTAGCATTGACGGAGGTGGCATCCGTGGCAT
rJMFF047N16+ GCAT
                      ____________________________________________________________
consensus CATCCCTCCCGGCGGCGTTATCACCATCCTTAGCATTGACGGAGGTGGCATCCGTGGCAT
 
. : . : . : . : . : . :
JMFF047N16- CATCCCCGGCACCATTGTCGCTTACCTTGAAGAGGAGCTTCAAGCTTTGGACGGTCCGGA
rJMFF047N16+ CATCCCCGGCACCATTGTCGCTTACCTTGAAGAGGAGCTTCAAGCTTTGGACGGTCCGGA
                      ____________________________________________________________
consensus CATCCCCGGCACCATTGTCGCTTACCTTGAAGAGGAGCTTCAAGCTTTGGACGGTCCGGA
 
. : . : . : . : . : . :
JMFF047N16- TGCAAGAGCAGCGGACTACTTCGATGTGATTGCCGGAACGAGCACCGGAGGGCTGATGAC
rJMFF047N16+ TGCAAGAGCAGCGGACTACTTCGATGTGATTGCCGGAACGAGCACCGGAGGGCTGATGAC
                      ____________________________________________________________
consensus TGCAAGAGCAGCGGACTACTTCGATGTGATTGCCGGAACGAGCACCGGAGGGCTGATGAC
 
. : . : . : . : . : . :
JMFF047N16- CACCATGTTATCGGCGCCGGACAAGAACAAGCGCCCCCTCTACGCCGGCAAGGATATTGT
rJMFF047N16+ CACCATGTTATCGGCGCCGGACAAGAACAAGCGCCCCCTCTACGCCGGCAAGGATATTGT
                      ____________________________________________________________
consensus CACCATGTTATCGGCGCCGGACAAGAACAAGCGCCCCCTCTACGCCGGCAAGGATATTGT
 
. : . : . : . : . : . :
JMFF047N16- CCCTTTCTACAAGGAGCACGGACCAAAGAATGAACCGGTCCCCAAAGCTGGAACAAACAA
rJMFF047N16+ CCCTTTCTACAAGGAGCACGGACCAAAGAATGAACCGGTCCCCAAAGCTGGAACAAACAA
                      ____________________________________________________________
consensus CCCTTTCTACAAGGAGCACGGACCAAAGAATGAACCGGTCCCCAAAGCTGGAACAAACAA
 
. : . : . : . : . : . :
JMFF047N16- AGATGCTCTGAAAAGGTTGGCCGGTTTGCTGTCGGAGGAGAGGAGGCGCCGTACAATCGC
rJMFF047N16+ AGATGCTCTGAAAAGGTTGGCCGGTTTGCTGTCGGAGGAGAGGAGGCGCCGTACAATCGC
                      ____________________________________________________________
consensus AGATGCTCTGAAAAGGTTGGCCGGTTTGCTGTCGGAGGAGAGGAGGCGCCGTACAATCGC
 
. : . : . : . : . : . :
JMFF047N16- GGCACTTAACGGCGGCAAGTAGTTAAGTTACGGTGTTGATCAACATTGAGATCATATGTA
rJMFF047N16+ GGCACTTAACGGCGGCAAGTAGTTAAGTTACGGTGTTGATCAACATTGAGATCATATGTA
                      ____________________________________________________________
consensus GGCACTTAACGGCGGCAAGTAGTTAAGTTACGGTGTTGATCAACATTGAGATCATATGTA
 
. : . : . : . : . : . :
JMFF047N16- TCGTGTGTCTTTAATTTCTGCTACTTGAATTATTGAA
rJMFF047N16+ TCGTGTGTCTTTAATTTCTGCTACTTGAATTATTGAATAAGGCACATATCCTTCGACATG
                      ____________________________________________________________
consensus TCGTGTGTCTTTAATTTCTGCTACTTGAATTATTGAATAAGGCACATATCCTTCGACATG
 
. : . : . : . : . : . :
rJMFF047N16+ AAAAAGGTTGTGCCATTGGGATTGGTTACATATGTATGCTTGTGTATTTTGTATAAACTA
                      ____________________________________________________________
consensus AAAAAGGTTGTGCCATTGGGATTGGTTACATATGTATGCTTGTGTATTTTGTATAAACTA
 
. : . : . : . : . : . :
rJMFF047N16+ GTAAGTGTCCCGTGCTATGTATGGACTATTATTAATGTAATAAATGATTAAATTATGTAC
                      ____________________________________________________________
consensus GTAAGTGTCCCGTGCTATGTATGGACTATTATTAATGTAATAAATGATTAAATTATGTAC