Previous Contig 010774:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047M22Sequence434015054gb:AB107692_15267508e-09Nicotiana tabacum AGP4 mRNA for AG-motif binding protein-4, complete cds.430010774 (2)gb:AB107692_15267503e-12Nicotiana tabacum AGP4 mRNA for AG-motif binding protein-4, complete cds.
JMFN005D05Sequence627010774 (2)gb:AB107692_15267501e-50Nicotiana tabacum AGP4 mRNA for AG-motif binding protein-4, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005D05- TACGGTTCTTCATCGCTTCCTGGTATGAGTTGT
                      ____________________________________________________________
consensus TACGGTTCTTCATCGCTTCCTGGTATGAGTTGT
 
. : . : . : . : . : . :
JMFN005D05- GCAAACCCTGTCCACGACGGCGACTTGTTTTCTAGCGTAGAAAAGCCGCCGGCGAAGAAG
                      ____________________________________________________________
consensus GCAAACCCTGTCCACGACGGCGACTTGTTTTCTAGCGTAGAAAAGCCGCCGGCGAAGAAG
 
. : . : . : . : . : . :
JMFN005D05- CTGAAGAGAAAGTCGTCGGTGGAGACCGGTCCAGGGTCAGGCGTGACACAGACTCTACGG
                      ____________________________________________________________
consensus CTGAAGAGAAAGTCGTCGGTGGAGACCGGTCCAGGGTCAGGCGTGACACAGACTCTACGG
 
. : . : . : . : . : . :
JMFN005D05- CGTTGTAGTCATTGTCAGGTTCAGAAGACTCCACAGTGGCGAACCGGTCCGATGGGTCCT
                      ____________________________________________________________
consensus CGTTGTAGTCATTGTCAGGTTCAGAAGACTCCACAGTGGCGAACCGGTCCGATGGGTCCT
 
. : . : . : . : . : . :
JMFN005D05- AAAACTTTGTGTAACGCTTGTGGCGTTAGGTACAAGTCCGGACGACTTTTCCCGGAGTAT
rJMFF047M22+ CCCGGAGTAT
                      ____________________________________________________________
consensus AAAACTTTGTGTAACGCTTGTGGCGTTAGGTACAAGTCCGGACGACTTTTCCCGGAGTAT
 
. : . : . : . : . : . :
JMFN005D05- AGACCGGCTTGCAGCCCCACTTTCTCTCTAGAGATTCACTCGAATAGTCACCGGAAAGTT
rJMFF047M22+ AGACCGGCTTGCAGCCCCACTTTCTCTCTAGAGATTCACTCGAATAGTCACCGGAAAGTT
                      ____________________________________________________________
consensus AGACCGGCTTGCAGCCCCACTTTCTCTCTAGAGATTCACTCGAATAGTCACCGGAAAGTT
 
. : . : . : . : . : . :
JMFN005D05- TTGGAGATGCGGCGGAAGAAGGAGGATACCGAGGTTATCGACGCCGGCTCCGGCTCCGGC
rJMFF047M22+ TTGGAGATGCGGCGGAAGAAGGGGGATACCGAGGTTATCGACGCCGGCTCCGGCTCCGGC
                      ____________________________________________________________
consensus TTGGAGATGCGGCGGAAGAAGGGGGATACCGAGGTTATCGACGCCGGCTCCGGCTCCGGC
 
. : . : . : . : . : . :
JMFN005D05- TCGACAACCCCGGCGCTTGTGGAGAATTTTCAATAGACGCCAAGGGGGACCGGTATTGTT
rJMFF047M22+ TCGACAACCCCGGCGCTTGTGGAGAATTTTCAATAGACTCCAAGGGGGACCGGTATTGTT
                      ____________________________________________________________
consensus TCGACAACCCCGGCGCTTGTGGAGAATTTTCAATAGACTCCAAGGGGGACCGGTATTGTT
 
. : . : . : . : . : . :
JMFN005D05- TGGTAGGTGTAGCTAGGTGGTGCGTCACATGTGCAATAGCAAATGGTAACGGCAGTGATA
rJMFF047M22+ TGGTAGGTGTAGCTAGGTGGTGCGTCACATGTGCAATAGCAAATGGTAACGGCAGTGATA
                      ____________________________________________________________
consensus TGGTAGGTGTAGCTAGGTGGTGCGTCACATGTGCAATAGCAAATGGTAACGGCAGTGATA
 
. : . : . : . : . : . :
JMFN005D05- GACTTTTGACGGAGTTTAGGGAGGTTATGATTTTTACTTTTTAGTGCACAATAGTTTTTA
rJMFF047M22+ GACTTTTGACGGAGTTTAGGGAGGTTATGATTTTTACTTTTTAGTGCACAATAGTTTTTA
                      ____________________________________________________________
consensus GACTTTTGACGGAGTTTAGGGAGGTTATGATTTTTACTTTTTAGTGCACAATAGTTTTTA
 
. : . : . : . : . : . :
JMFN005D05- GTTTGGTTGTAATTTAGTCGCAGCTTAGTGTAACGGAGTTACGTGATGTAGTAC
rJMFF047M22+ GTTTGGTTGTAATTTAGTCGCAGCTTAGTGTAACGGAGTTACGTGATGTAGTACTAATAT
                      ____________________________________________________________
consensus GTTTGGTTGTAATTTAGTCGCAGCTTAGTGTAACGGAGTTACGTGATGTAGTACTAATAT
 
. : . : . : . : . : . :
rJMFF047M22+ TTAAATTGTTGTTGCCCCTAAAAAAAAAAAAAAAACTCGCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTAAATTGTTGTTGCCCCTAAAAAAAAAAAAAAAACTCGCCAGGGTGATCCGCCATAAGG