Previous Contig 010761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M23Sequence497000401 (4)435010761 (5)gb:ATAJ3119_15438912e-21Arabidopsis thaliana AtP2C-HA gene.
JMFF022A11Sequence310000401 (4)753010761 (5)gb:AC130728_17409142e-73Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08, complete seq
JMFF026H07Sequence310014593736010761 (5)gb:ATAJ3119_15438916e-46Arabidopsis thaliana AtP2C-HA gene.
JMFF038K14Sequence724010761 (5)gb:AC130728_17409141e-71Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08, complete seq
JMFF047K15Sequence573000401 (4)496010761 (5)gb:AC130728_17409143e-07Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022A11+ CACC
                      ____________________________________________________________
consensus CACC
 
. : . : . : . : . : . :
rJMFF038K14+ TACCGCTGTGGTTGCCATTCTTTGTCCCACTAATATAATTGTAGC
rJMFF022A11+ AGAAGCAGTTGGATCTACCGCTGTGGTTGCCATTCTTTGTCCCACTAATATAATNGTAGC
                      ____________________________________________________________
consensus AGAAGCAGTTGGATCTACCGCTGTGGTTGCCATTCTTTGTCCCACTAATATAATTGTAGC
 
. : . : . : . : . : . :
rJMFF038K14+ AAATTGTGGCGATTCTAGGGCAGTCCTGTGCCGGGGAAAATTACCCATGCCATTGTCAGT
rJMFF022A11+ AAATTGTGGCGATTCTAGGGCAGTCCTGTGCCGGGGAAAATTACCCATGCCATTGTCAGT
                      ____________________________________________________________
consensus AAATTGTGGCGATTCTAGGGCAGTCCTGTGCCGGGGAAAATTACCCATGCCATTGTCAGT
 
. : . : . : . : . : . :
rJMFF038K14+ CGATCACAAACCAAATAGAGAAGATGAGTACTCGAGAATCGAAGCTTTGGGAGGCAAGGT
rJMFF022A11+ CGATCACAAACCAAATAGAGAAGATGAGTACTCGAGAATCGAAGCTTTGGGAGGCAAGGT
rJMFF026H07+ TAGAGAAGATGAGTACTCGAGAATCGAAGCTTTGGGAGGCAAGGT
                      ____________________________________________________________
consensus CGATCACAAACCAAATAGAGAAGATGAGTACTCGAGAATCGAAGCTTTGGGAGGCAAGGT
 
. : . : . : . : . : . :
rJMFF038K14+ CATTAATTGGGATGGGCACCGCGTTTCTGGTGTGCTTGCAGTTTCAAGATCCATTGGTGA
rJMFF022A11+ CATTAATTGGGATGGGCACCGCGTTTCTGGTGTGCTTGCAGTTTCAAGATCCATTGGTGA
rJMFF026H07+ CATTAATTGGGATGGGCNCCGCGTTTCTGGTGTGCTTGCAGTTTCAAGATCCATTGGTGA
                      ____________________________________________________________
consensus CATTAATTGGGATGGGCACCGCGTTTCTGGTGTGCTTGCAGTTTCAAGATCCATTGGTGA
 
. : . : . : . : . : . :
rJMFF038K14+ TAGATATCTGAGGCCATATGTGATACCAGTACCGGAGATAATGTTTGTCCCACGGGCAAA
rJMFF022A11+ TAGATATCTGAGGCCATATGTGATACCAGTACCGGAGATAATGTTTGTCCCACGGGCAAA
rJMFF007M23+ GATAATNTTTGTCCCCCGGGCAAA
rJMFF026H07+ TAGATATCTGAGGCCATATGTGATACCAGTACCGGAGATAATGTTTGTCCCACGGGCAAA
                      ____________________________________________________________
consensus TAGATATCTGAGGCCATATGTGATACCAGTACCGGAGATAATGTTTGTCCCACGGGCAAA
 
. : . : . : . : . : . :
rJMFF038K14+ AGAAGACGAGTGCCTTGTTTTAGCGAGCGATGGTCTATGGGATGTGATGACTAACGAGGA
rJMFF022A11+ AGAAGACGAGTGCCTTGTTTTAGCGAGCGATGGTCTATGGGATGTGATGACTAACGAGGA
rJMFF007M23+ AGAAGACGAGTGCCTTGTTTTAGNGAGCGATGGTTTNTGGGATGTGATGACTAACGAGGA
rJMFF026H07+ AGAAGACGAGTGCCTTGTTTTAGCGAGCGATGGTCTATGGGATGTGATGACTAACGAGGA
                      ____________________________________________________________
consensus AGAAGACGAGTGCCTTGTTTTAGCGAGCGATGGTCTATGGGATGTGATGACTAACGAGGA
 
. : . : . : . : . : . :
rJMFF038K14+ GGTGTGTGATGTGGCAAGGCGACGGCTTCTGCTCTGGCACAAGAAGAATGGCGGTACTAT
rJMFF022A11+ GGTGTGTGATGTGGCAAGGCGACGGCTTCTGCTCTGGCACAAGAAGAATGGCGGTACTAT
rJMFF007M23+ GGTGTGTGATGTGGCAAGGCGACGGCTTTTGCTTTGGCNCAAGAAGAATGGCGGTNCTAT
rJMFF026H07+ GGTGTGTGATGTGGCAAGGCGACGGCTTNTGCTNTGGCACAAGAAGAATGGCGGTACTAT
                      ____________________________________________________________
consensus GGTGTGTGATGTGGCAAGGCGACGGCTTCTGCTCTGGCACAAGAAGAATGGCGGTACTAT
 
. : . : . : . : . : . :
rJMFF038K14+ GCTGTCTAGAGAAAGAAGCGACGACCCTGACCCAGCCGCCCAAGATGCAGCAGAGTACCT
rJMFF022A11+ GCTGTCTAGAGAAAGAAGCGACGACCCTGACCCAGCCGCCCAAGATGCAGCAGAGTACCT
rJMFF007M23+ GCTGTTTNGAGAAAGAAGNGACGNCCCTGACCCNNCCGCCCNAGATGCAGCAGAGTNCCT
rJMFF026H07+ GCTGTNTAGAGAAAGAAGCGACGACCCTGACCCAGCCGCCCAAGATGCAGCAGAGTACCT
rJMFF047K15+ ATGCAGCAGAGTACCT
                      ____________________________________________________________
consensus GCTGTCTAGAGAAAGAAGCGACGACCCTGACCCAGCCGCCCAAGATGCAGCAGAGTACCT
 
. : . : . : . : . : . :
rJMFF038K14+ CACCCGAATCGCCCTCCAAAGGGGAAGCAGAGATAACATCTCGGTTATTGTGGTGGATCT
rJMFF022A11+ CACCCGAATCGCCCTCCAAAGGGGAAGCAGAGATAACATCTCGATTATTGTGGTGGATCT
rJMFF007M23+ CNCCCGAATNGCCCTCCAAAGGGGAAGCNGAGATAACATNTCGGNTNTTGTGGNGGATTT
rJMFF026H07+ CACCCGAATCGCCCTCCAAAGGGGAAGCAGAGATAACATCTCGGTTATTGTGGTGGATNT
rJMFF047K15+ CACCCGAATCGCCCTCCAAAGGGGAAGCAGAGATAACATCTCGGTTATTGTGGTGGATCT
                      ____________________________________________________________
consensus CACCCGAATCGCCCTCCAAAGGGGAAGCAGAGATAACATCTCGGTTATTGTGGTGGATCT
 
. : . : . : . : . : . :
rJMFF038K14+ AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGTGTTGTTACTAAATAATAATCTTAAA
rJMFF022A11+ AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGTGTTGTTACTAAATAATAATCTTAAA
rJMFF007M23+ AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGNGTTGNTNCTAAATAATAATTTTAAA
rJMFF026H07+ AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGTGTTGTTACTAAATAATAATCTTAAA
rJMFF047K15+ AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGTGTTGTTACTAAATAATAATCTTAAA
                      ____________________________________________________________
consensus AAAGGCTCAAAGGAAGTTCAAGAAGAAAGCATAGTGTTGTTACTAAATAATAATCTTAAA
 
. : . : . : . : . : . :
rJMFF038K14+ CTCGGTTCCCAACTTCCCACGTCGTTAATCTAGCAGAACCTAGCTTCGGTTTGAGTTTCT
rJMFF022A11+ CTCGGTTCCCAACTTCCCACGTCGTTAATCTAGCAGAACCTAGCTTCGGTTTGAGTTTCT
rJMFF007M23+ CTCGGTTCCCAACTTCCCNCGTNGNTAATTTAGCAGAACCTAGNTTCGGTTTGAGTTTNT
rJMFF026H07+ CTCGGTTCCCAACTTCCCACGTCGTTAATNTAGCAGAACCTAGCTTCGGTTTGAGTTTCT
rJMFF047K15+ CTCGGTTCCCAACTTCCCACGTCGTTAATCTAGCAGAACCTAGCTTCGGTTTGAGTTTCT
                      ____________________________________________________________
consensus CTCGGTTCCCAACTTCCCACGTCGTTAATCTAGCAGAACCTAGCTTCGGTTTGAGTTTCT
 
. : . : . : . : . : . :
rJMFF038K14+ TGCTGGCTAGGTTAGTGCAGCAGTCTTATGC---TCTTCTTCTTCTTCTTCTTCTGTTAT
rJMFF022A11+ TGCTGGCTAGGTTAGTGCAGCAGTCTTATGC---TCTTCTTCTTCTTCTTCTTCTGTTAT
rJMFF007M23+ TGCTGGNTAGGNTAGNGCAGCAGTNTTATG
rJMFF026H07+ TGCTGGCTAGGTTAGTGCAGCAGTCTTATGC---TCTTCTTCTTCTTCTTCTTCTGTTAT
rJMFF047K15+ TGCTGGCTAGGTTAGTGCAGCAGTCTTATGCTCTTCTTCTTCTTCTTCTTCTTCTGTTAT
                      ____________________________________________________________
consensus TGCTGGCTAGGTTAGTGCAGCAGTCTTATGC---TCTTCTTCTTCTTCTTCTTCTGTTAT
 
. : . : . : . : . : . :
rJMFF038K14+ GGCACATTACAGTAAATACAGT
rJMFF022A11+ GGCACATTACAGTAAATACAGTATCCTAACAA
rJMFF026H07+ GGCACATTACAGTAAATACAGTATCCTAACAAATATATTNTGAGCTTTGATCTCTAGCAG
rJMFF047K15+ GGCACATTACAGTAAATACAGTATCCTAACAAATATATTCTGAGCTTTGATCTCTAGCAG
                      ____________________________________________________________
consensus GGCACATTACAGTAAATACAGTATCCTAACAAATATATTCTGAGCTTTGATCTCTAGCAG
 
. : . : . : . : . : . :
rJMFF026H07+ TCTGACTGGGCAGTGAAAGAACCACTTTACGAGTTTTACTACGTGTACTCCCAATTCTTA
rJMFF047K15+ TCTGACTGGGCAGTGAAAGAACCACTTTACGAGTTTTACTACGTGTACTCCCAATTCTTA
                      ____________________________________________________________
consensus TCTGACTGGGCAGTGAAAGAACCACTTTACGAGTTTTACTACGTGTACTCCCAATTCTTA
 
. : . : . : . : . : . :
rJMFF026H07+ CTCTCTCGCTTTTATTTCATGATGTGACAGACAC
rJMFF047K15+ CTCTCTCGCTTTTATTTCATGATGTGACAGACACTGATAAACTTTTTTTTTTCCATGTGG
                      ____________________________________________________________
consensus CTCTCTCGCTTTTATTTCATGATGTGACAGACACTGATAAACTTTTTTTTTTCCATGTGG
 
. : . : . : . : . : . :
rJMFF047K15+ GCCCTAGTACAAGTGCGTCTTTTACAACATCACTTCTATAACAAATTCTTGTGTTCCAAG
                      ____________________________________________________________
consensus GCCCTAGTACAAGTGCGTCTTTTACAACATCACTTCTATAACAAATTCTTGTGTTCCAAG