Previous Contig 010753:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047J11Sequence626006168 (7)gb:AF428398_17993283e-62Arabidopsis thaliana At2g30360/T9D9.17 mRNA, complete cds.596010753 (2)gb:AY220480_15905142e-22Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 216 (ACRE216) mRNA, complet
JMFN016N04Sequence626010753 (2)pir|E84707|E847072e-59probable protein kinase [imported] - Arabidopsis thaliana>gb:AC002338_1530492 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016N04- TCCGCCGGA
                      ____________________________________________________________
consensus TCCGCCGGA
 
. : . : . : . : . : . :
JMFN016N04- CGGTTTACTCCACACGCTTTGCGGAACGCCGGCCTACGTCGCGCCGGAGATTCTGTCGAA
                      ____________________________________________________________
consensus CGGTTTACTCCACACGCTTTGCGGAACGCCGGCCTACGTCGCGCCGGAGATTCTGTCGAA
 
. : . : . : . : . : . :
JMFN016N04- GAAAGGCTACGACGGAGCCAAAGTCGACGTCTGGTCGTGTGGAGTCATCCTCTACGTTCT
                      ____________________________________________________________
consensus GAAAGGCTACGACGGAGCCAAAGTCGACGTCTGGTCGTGTGGAGTCATCCTCTACGTTCT
 
. : . : . : . : . : . :
JMFN016N04- CACCGCCGGATTCCTGCCGTTCAACGATCCGAATTTGATGGTGATGTATAAGAAGATTTA
                      ____________________________________________________________
consensus CACCGCCGGATTCCTGCCGTTCAACGATCCGAATTTGATGGTGATGTATAAGAAGATTTA
 
. : . : . : . : . : . :
JMFN016N04- CAAGGGCGAGTTCCGGTACCCTAAATGGATGTCGCCGGATCTCAAACGCCTTTTATCTCG
                      ____________________________________________________________
consensus CAAGGGCGAGTTCCGGTACCCTAAATGGATGTCGCCGGATCTCAAACGCCTTTTATCTCG
 
. : . : . : . : . : . :
JMFN016N04- AATTCTCGACACCAATCCGGAGACGAGGATCACCATCGACGAGATCATCGAAGATCCGTG
                      ____________________________________________________________
consensus AATTCTCGACACCAATCCGGAGACGAGGATCACCATCGACGAGATCATCGAAGATCCGTG
 
. : . : . : . : . : . :
JMFN016N04- GTTCCGGAAAGGATCCAAAGGAAAGCTGAAATTCTACGACGAATTCCTGCAAGTCAACAA
rJMFF047J11+ CGGAAAGGATCCAAAGGAAAGCTGAAATTCTACGACGAATTCCTGCAAGTCAACAA
                      ____________________________________________________________
consensus GTTCCGGAAAGGATCCAAAGGAAAGCTGAAATTCTACGACGAATTCCTGCAAGTCAACAA
 
. : . : . : . : . : . :
JMFN016N04- GGAAGAAGGTCCGAGCCCTAGCAGCGCGTCCTGTTTAAACGCCTTCAACCTAATATCCTT
rJMFF047J11+ GGAAGAAGGTCCGAGCCCTAGCAGCGCGTCCTGTTTAAACGCCTTCAACCTAATATCCTT
                      ____________________________________________________________
consensus GGAAGAAGGTCCGAGCCCTAGCAGCGCGTCCTGTTTAAACGCCTTCAACCTAATATCCTT
 
. : . : . : . : . : . :
JMFN016N04- CTCCTCCGGGCTGGACCTATCCGGATTGTTCGACGGCGCGTCAAGCTCCGTCACCGACTC
rJMFF047J11+ CTCCTCCGGGCTGGACCTATCCGGATTGTTCGACGGCGCGTCAAGCTCCGTCACCGACTC
                      ____________________________________________________________
consensus CTCCTCCGGGCTGGACCTATCCGGATTGTTCGACGGCGCGTCAAGCTCCGTCACCGACTC
 
. : . : . : . : . : . :
JMFN016N04- CGAGAGAATAGTGGTGGAGTCGGCGCCGGAGAAAGTGATGGAGCGAGTCGAGAGATTCGC
rJMFF047J11+ CGAGAGAATAGTGGTGGAGTCGGCGCCGGAGAAAGTGATGGAGCGAGTCGAGAGATTCGC
                      ____________________________________________________________
consensus CGAGAGAATAGTGGTGGAGTCGGCGCCGGAGAAAGTGATGGAGCGAGTCGAGAGATTCGC
 
. : . : . : . : . : . :
JMFN016N04- TGCGGCGGAGAAGATCAGACTGAGGAAAAGGAAGGAATTGNGAATCGATCTGGAAGGGCA
rJMFF047J11+ TGCGGCGGAGAAGATCAGACTGAGGAAAAGGAAGGAATTGGGAATCGATCTGGAAGGGCA
                      ____________________________________________________________
consensus TGCGGCGGAGAAGATCAGACTGAGGAAAAGGAAGGAATTGGGAATCGATCTGGAAGGGCA
 
. : . : . : . : . : . :
JMFN016N04- GAATGGGAAATTCATCG
rJMFF047J11+ GAATGGGAAATTCATCGCCAGCTTGGAGGTTTATCGTTTGAACGATCGTATGGTCGTGGT
                      ____________________________________________________________
consensus GAATGGGAAATTCATCGCCAGCTTGGAGGTTTATCGTTTGAACGATCGTATGGTCGTGGT
 
. : . : . : . : . : . :
rJMFF047J11+ GGAAGGCAAAAGGACGGCCGGCGACCCCGAAATGTTCAGAGAGTCATGGAGGGAAAAGAT
                      ____________________________________________________________
consensus GGAAGGCAAAAGGACGGCCGGCGACCCCGAAATGTTCAGAGAGTCATGGAGGGAAAAGAT
 
. : . : . : . : . : . :
rJMFF047J11+ TAAGCCGGCGATTTTAAGCCGATCGGAGAATCAGGTTTCCGGTAGCTGCTAGACTACTTC
                      ____________________________________________________________
consensus TAAGCCGGCGATTTTAAGCCGATCGGAGAATCAGGTTTCCGGTAGCTGCTAGACTACTTC
 
. : . : . : . : . : . :
rJMFF047J11+ ACCGCCGCCGGCGGGATCTAGAACAACGTTCGTACTTACGGACATTAAATTATCATTACA
                      ____________________________________________________________
consensus ACCGCCGCCGGCGGGATCTAGAACAACGTTCGTACTTACGGACATTAAATTATCATTACA
 
. : . : . : . : . : . :
rJMFF047J11+ TTATTATGATTATTATATTATATGTATAAAAAATATTTCTATTAATTATTATTTGATCAT
                      ____________________________________________________________
consensus TTATTATGATTATTATATTATATGTATAAAAAATATTTCTATTAATTATTATTTGATCAT