Previous Contig 010752:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005I09Sequence607010752 (5)gb:AF114750_17692153e-62Arabidopsis thaliana v-SNARE AtVTI1a (VTI1a) mRNA, complete cds.
JMFF025I20Sequence435010752 (5)gb:AK118255_18162428e-43Arabidopsis thaliana At3g29100 mRNA for putative vesicle transport protein, comp
JMFF047J09Sequence638010752 (5)sp|Q9SEL6|VT11_ARATH2e-59Vesicle transport v-SNARE 11 (AtVTI11) (Vesicle transport v-SNARE protein VTI1a)602010752 (5)gb:AK118255_18162423e-46Arabidopsis thaliana At3g29100 mRNA for putative vesicle transport protein, comp
JMFN018C18Sequence599010752 (5)gb:AP003273_18269538e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047J09- GTTGAACCGACCAACGGAATAC
                      ____________________________________________________________
consensus GTTGAACCGACCAACGGAATAC
 
. : . : . : . : . : . :
JMFF047J09- XXXXXXXXXXXXXXXXXXXCAAAAGGCGATCAATCTCCGTCCGGCCGGCGAATTTTCCGG
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNCAAAAGGCGATCAATCTCCGTCCGGCCGGCGAATTTTCCGG
 
. : . : . : . : . : . :
JMFF047J09- CAATCCTGCGATCACTTCAAGGTAATCAGTGTAAACCTAGCTAACAGAATGAGTCAGGTG
                      ____________________________________________________________
consensus CAATCCTGCGATCACTTCAAGGTAATCAGTGTAAACCTAGCTAACAGAATGAGTCAGGTG
 
. : . : . : . : . : . :
JMFF047J09- TTCGAAGGATACGAACGGCAATATTGTGAGCTTTCCGCTAATTTAACGAAGAAGTGCACC
                      ____________________________________________________________
consensus TTCGAAGGATACGAACGGCAATATTGTGAGCTTTCCGCTAATTTAACGAAGAAGTGCACC
 
. : . : . : . : . : . :
JMFF047J09- TCAGCTACTCTCCTTGATGGAGAGCAAAAGAAGCAGAAAATTTCCGAAGTAAAAAATGGA
rJMFF005I09+ GATGGAGAGCAAAAGAAGCAGAAAATTTCCGAAGTAAAAAATGGA
JMFN018C18- TGGA
                      ____________________________________________________________
consensus TCAGCTACTCTCCTTGATGGAGAGCAAAAGAAGCAGAAAATTTCCGAAGTAAAAAATGGA
 
. : . : . : . : . : . :
JMFF047J09- ATGGAAGATGCGGAGGCATTGATCCGCAAAATGGATCTTGAGGCTAGGAGTTTACCACCA
rJMFF005I09+ ATGGAAGATGCGGAGGCATTGATCCGCAAAATGGATCTTGAGGCTAGGAGTTTACCACCA
JMFN018C18- ATGGAAGATTCGGAGGCATTGATCCGCAAAATGGATCTTGAGGCTAGGAGTTTACCACCA
rJMFF047J09+ CA
                      ____________________________________________________________
consensus ATGGAAGATGCGGAGGCATTGATCCGCAAAATGGATCTTGAGGCTAGGAGTTTACCACCA
 
. : . : . : . : . : . :
JMFF047J09- AATGCAAAAGCCATGCTTCTTGCAAAGTTAAGAGAATATAAAAGTGATTTGAACAATTTG
rJMFF005I09+ AATGCAAAAGCCATGCTTCTTGCAAAGTTAAGAGAATATAAAAGTGATTTGAACAATTTG
rJMFF025I20+ CTTCTTGCAAAGTTAAGAGAATATAAAAGTGATCNGAACAATTTG
JMFN018C18- AATGCAAAAGCCATGCTTCTTGCAAAGTTAAGAGAATATAAAAGTGATTTGAACAATTTG
rJMFF047J09+ AATGCAAAAGCCATGCTTCTTGCAAAGTTAAGAGAATATAAAAGTGATTTGAACAATTTG
                      ____________________________________________________________
consensus AATGCAAAAGCCATGCTTCTTGCAAAGTTAAGAGAATATAAAAGTGATTTGAACAATTTG
 
. : . : . : . : . : . :
JMFF047J09- AAAACTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCCTCAAGGGATGAGTTG
rJMFF005I09+ AAAACTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCCTCAAGGGATGAGTTG
rJMFF025I20+ AAAANTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCNTCAAGGGATGAGTTG
JMFN018C18- AAAACTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCCTCAAGGGATGAGTTG
rJMFF047J09+ AAAACTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCCTCAAGGGATGAGTTG
                      ____________________________________________________________
consensus AAAACTGAAGTGAAAAGAATTACATCAGATAATGCTAACCAAGCCTCAAGGGATGAGTTG
 
. : . : . : . : . : . :
JMFF047J09- TTGGAATCTGGGATGGCAGATGCTAAGATGGTATCTGCTGATCAAAGGCAAAGGTTGATG
rJMFF005I09+ TTGGAATCTGGGATGGCAGATGCTAAGATGGTATCTGCTGATCAAAGGCAAAGGTTGATG
rJMFF025I20+ TTGGAATNTGGGATGGCAGATGNTAAGATGGTATNTGCTGATCAAAGGCAAAGGTTGATG
JMFN018C18- TTGGAATCTGGGATGGCAGATGCTAAGATGGTATCTGCTGATCAAAGGCAAAGGTTGATG
rJMFF047J09+ TTGGAATCTGGGATGGCAGATGCTAAGATGGTATCTGCTGATCAAAGGCAAAGGTTGATG
                      ____________________________________________________________
consensus TTGGAATCTGGGATGGCAGATGCTAAGATGGTATCTGCTGATCAAAGGCAAAGGTTGATG
 
. : . : . : . : . : . :
JMFF047J09- ATGTCAACTGAGAGATTAAACAAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
rJMFF005I09+ ATGTCAACTGAGAGATTAAACAAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
rJMFF025I20+ ATGTCANNTGAGAGANTAANCNAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
JMFN018C18- ATGTCAACTGAGAGATTAAACAAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
rJMFF047J09+ ATGTCAACTGAGAGATTAAACAAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
                      ____________________________________________________________
consensus ATGTCAACTGAGAGATTAAACAAGTCCAGTGATAGAATCAGAGAAGGCCGGAAAGTTATG
 
. : . : . : . : . : . :
JMFF047J09- CTGGAAACCGAAGAACTTGGAGTTTCAATTCTTNCAGATCTGCGCCAACAACGTCAGTCT
rJMFF005I09+ CTGGAAACCGAAGAACTTGGAGTTTCAATTCTTCAAGATCTGCGCCAACAACGTCAGTCT
rJMFF025I20+ CTGGAAACCGAAGANCTTGGAGTTTCAATTNTTCAAGATCTGCACCAACNACGTCAGTCT
JMFN018C18- CTGGAAACCGAAGAACTTGGAGTTTCAATTCTTCAAGATCTGCACCAACAACGTCAGTCT
rJMFF047J09+ CTGGAAACCGAAGAACTTGGAGTTTCAATTCTTCAAGATCTGCGCCAACAACGTCAGTCT
                      ____________________________________________________________
consensus CTGGAAACCGAAGAACTTGGAGTTTCAATTCTTCAAGATCTGCGCCAACAACGTCAGTCT
 
. : . : . : . : . : . :
JMFF047J09- CTCCTGCATGCACATG
rJMFF005I09+ CTCCTGCATGCACATGATACGCTTCATGGGGTGGATGACAATATCAGCAGGAGCAAGAAG
rJMFF025I20+ CTNCCGCATGCACATGATNCGCTTCATGGGGTGGATGACAATATCAGCAGGAGCAAGAAG
JMFN018C18- CTCCTGCATGCACATGATACGCTTCATGGGGTGGATGACAATATCAGCAGGAGCAAGAAG
rJMFF047J09+ CTCCTGCATGCACATGATACGCTTCATGGGGTGGATGACAATATCAGCAGGAGCAAGAAG
                      ____________________________________________________________
consensus CTCCTGCATGCACATGATACGCTTCATGGGGTGGATGACAATATCAGCAGGAGCAAGAAG
 
. : . : . : . : . : . :
rJMFF005I09+ ATACTGACCACAATGTCAAGAAGGATGAACAGGAACAAATGGATCATCGGTTCAATCATT
rJMFF025I20+ ATNCTGACCACAATGTCAAGAAGGATGAACAGGAACAAATGGATCATCGGTTCAATCATT
JMFN018C18- ATACTGACCACAATGTCAAGAAGGATGAACAGGAACAAATGGATCATCGGTTCAATCATT
rJMFF047J09+ ATACTGACCACAATGTCAAGAAGGATGAACAGGAACAAATGGATCATCGGTTCAATCATT
                      ____________________________________________________________
consensus ATACTGACCACAATGTCAAGAAGGATGAACAGGAACAAATGGATCATCGGTTCAATCATT
 
. : . : . : . : . : . :
rJMFF005I09+ GCTGTCNTAGTGGTTGCAATCATATTGATTGTTTATTTCAAGCTTAGCCATTAGT
rJMFF025I20+ GCTGTCNTAGTGGTTGCAATCATAT
JMFN018C18- GCTGTCCTAGTGGTTGCAATCATATTGATTGTTTATTTCAAGCTTAGCCATTAGT
rJMFF047J09+ GCTGTCCTAGTGGTTGCAATCATATTGATTGTTTATTTCAAGCTTAGCCATTAGTTGAAG
                      ____________________________________________________________
consensus GCTGTCCTAGTGGTTGCAATCATATTGATTGTTTATTTCAAGCTTAGCCATTAGTTGAAG
 
. : . : . : . : . : . :
rJMFF047J09+ TGTCCCAGGCTTTGGATATGGCTGACATATGTTGTTTTCTTTTTTTGATTTCTGGTTCTC
                      ____________________________________________________________
consensus TGTCCCAGGCTTTGGATATGGCTGACATATGTTGTTTTCTTTTTTTGATTTCTGGTTCTC
 
. : . : . : . : . : . :
rJMFF047J09+ TGGTGTCCTTGTGTGGAATTTGAAACTGCATTTCTATGTTTGCAATTCTTATATAATGGC
                      ____________________________________________________________
consensus TGGTGTCCTTGTGTGGAATTTGAAACTGCATTTCTATGTTTGCAATTCTTATATAATGGC