Previous Contig 010746:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047I04Sequence442004800 (6)gb:ATAC010797_15431562e-29Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc425010746 (3)gb:AB017070_15134780.024Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNL12.
JMFS007G11Sequence604010746 (3)gb:AB017070_15134785e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNL12.
JMSF014E14Sequence537004800 (6)gb:ATAC010797_15431566e-21Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc772010746 (3)gb:AB017070_15134789e-36Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNL12.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014E14+ GAGAATGATAGTANCGATANTCCTCCGGATGGCAAGCAACAAGAGCCTTCCAAGCCAT
                      ____________________________________________________________
consensus GAGAATGATAGTANCGATANTCCTCCGGATGGCAAGCAACAAGAGCCTTCCAAGCCAT
 
. : . : . : . : . : . :
JMFS007G11- TGGCTGATC
rJMSF014E14+ TCAGACTCCTGAATGAATTAAGCGATCTGATGATGCTTCCGTNTGACATGGTGGCTGATC
                      ____________________________________________________________
consensus TCAGACTCCTGAATGAATTAAGCGATCTGATGATGCTTCCGTNTGACATGGTGGCTGATC
 
. : . : . : . : . : . :
JMFS007G11- CACAAACAAGAAAAGAAGTTTGTGCAACGTTCTCTCCGACACTGATCAAGATGATTCTTA
rJMSF014E14+ CACAAACAAGAAAAGAAGTTTGTGCAACGTTCTCTCCGACACTGATCAAGATGATTCTTA
                      ____________________________________________________________
consensus CACAAACAAGAAAAGAAGTTTGTGCAACGTTCTCTCCGACACTGATCAAGATGATTCTTA
 
. : . : . : . : . : . :
JMFS007G11- GCGGTTTTGTTCCCGATGAATTCTACCAAAAGCGAGTTCCCCAAGAAGTTTTCGATGCCC
rJMSF014E14+ GCGGTTTTGTTCCCGATGAATTCTACCAAAAGCGAGTTCCCCAAGAAGTTTTCGATGCCC
                      ____________________________________________________________
consensus GCGGTTTTGTTCCCGATGAATTCTACCAAAAGCGAGTTCCCCAAGAAGTTTTCGATGCCC
 
. : . : . : . : . : . :
JMFS007G11- TTGATGCCGAGGATGATGTAGATACAAACGGAGAGCGTGTGACTAGCTTTCCTTGTAGCG
rJMSF014E14+ TTGATGCCGAGGATGATGTAGATACAAACGGAGAGCGTGTGACTAGCTTTCCTTGTAGCG
                      ____________________________________________________________
consensus TTGATGCCGAGGATGATGTAGATACAAACGGAGAGCGTGTGACTAGCTTTCCTTGTAGCG
 
. : . : . : . : . : . :
JMFS007G11- CTACTCCCATAGTCTATTCACCGCCTTCTGCAGCCTCAGTCACCAGGTCCATCGGAGAAG
rJMSF014E14+ CTACTCCCATAGTCTATTCACCGCCTTCTGCAGCCTCAGTCACCAGGTCCATCGGAGAAG
                      ____________________________________________________________
consensus CTACTCCCATAGTCTATTCACCGCCTTCTGCAGCCTCAGTCACCAGGTCCATCGGAGAAG
 
. : . : . : . : . : . :
JMFS007G11- TTGGATCCCAATCTTTATCCCGCAATGGATCATCAGTTCTGAAAAAATCCTACACTAGTG
rJMSF014E14+ TTGGATCCCAATCTTTATCCCGCAATGGATCATCAGTTCTGAAAAAATCCTACACTAGTG
rJMFF047I04+ TAGTG
                      ____________________________________________________________
consensus TTGGATCCCAATCTTTATCCCGCAATGGATCATCAGTTCTGAAAAAATCCTACACTAGTG
 
. : . : . : . : . : . :
JMFS007G11- ATGATGAGCTGGATGAGCTCGACTCGCCCTTGACTTCCATTACAGCTGATAGATCTCGGG
rJMSF014E14+ ATGATGAGCTGGATGAGCTCGACTCGCCCTTGACTTCCATTACAGCTGATAGATCTCGGG
rJMFF047I04+ ATGATGAGCTGGATGAGCTCGACTCGCCCTTGACTTCCATTACAGCTGATAGATCTCGGG
                      ____________________________________________________________
consensus ATGATGAGCTGGATGAGCTCGACTCGCCCTTGACTTCCATTACAGCTGATAGATCTCGGG
 
. : . : . : . : . : . :
JMFS007G11- GATCTTCTTCGGTGAAGATAAACTGGAGCCCCAAAGGCGGCAAGGGCTGCCGGAATATTG
rJMSF014E14+ GATCTTCTTCGGTGAAGATAAACTGGAGCCCCAAAGGCGGCAAGGGCTGCCGGAATATTG
rJMFF047I04+ GATCTTCTTCGGTGAAGATAAACTGGAGCCCCAAAGGCGGCAAGGGCTGCCGGAATATTG
                      ____________________________________________________________
consensus GATCTTCTTCGGTGAAGATAAACTGGAGCCCCAAAGGCGGCAAGGGCTGCCGGAATATTG
 
. : . : . : . : . : . :
JMFS007G11- TCAGGTATCAGCTACTCCGAGAAGTATGGAGAGACGACGAACAATGAGATGGTGAACATA
rJMSF014E14+ TCAGGTATCAGCTACTCCGAGAAGTATGGAGAGACGACGAACAATGAGATGGTGAACATA
rJMFF047I04+ TCAGGTATCAGCTACTCCGAGAAGTATGGAGAGACGACGAACAATGAGATGGTGAACATA
                      ____________________________________________________________
consensus TCAGGTATCAGCTACTCCGAGAAGTATGGAGAGACGACGAACAATGAGATGGTGAACATA
 
. : . : . : . : . : . :
JMFS007G11- TAACATATGCAATATATGTATGAGTTATTCCTTCTAATTACACTTTTAAGAAGTTTTTGA
rJMSF014E14+ TAACATATGCAATATATGTATGAGTTATTCCTTCTAATTACACTTTTAAGAAGTTTTTGA
rJMFF047I04+ TAACATATGCAATATATGTATGAGTTATTCCTTCTAATTACACTTTTAAGAAGTTTTTGA
                      ____________________________________________________________
consensus TAACATATGCAATATATGTATGAGTTATTCCTTCTAATTACACTTTTAAGAAGTTTTTGA
 
. : . : . : . : . : . :
JMFS007G11- GCAGGAGATTATTGTGATTACGGAGTATTATTTTTCGTGTGAAGTCGGGTAAATA
rJMSF014E14+ GCAGGAGATTATTGTGATTACGGAGTATTATTTTTCGTGTGAAGTCGGGTAAATAGAATG
rJMFF047I04+ GCAGGAGATTATTGTGATTACGGAGTATTATTTTTCGTGTGAAGTCGGGTAAATAGAATG
                      ____________________________________________________________
consensus GCAGGAGATTATTGTGATTACGGAGTATTATTTTTCGTGTGAAGTCGGGTAAATAGAATG
 
. : . : . : . : . : . :
rJMSF014E14+ TAGATGGCGCAATCTATATAAGAAGATGAATCTTTATATTTTGTGTAATGAATT
rJMFF047I04+ TAGATGGCGCAATCTATATAAGAAGATGAATCTTTATATTTTGTGTAATGAATTACCACG
                      ____________________________________________________________
consensus TAGATGGCGCAATCTATATAAGAAGATGAATCTTTATATTTTGTGTAATGAATTACCACG
 
. : . : . : . : . : . :
rJMFF047I04+ TTGGTGGATATATGAAATCAGATTTGTTGAATCTAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTGGTGGATATATGAAATCAGATTTGTTGAATCTAAAAAAAAAAAAAAACTCTCCAGGGT