Previous Contig 010737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041D05Sequence656000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es622010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041D11Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es652010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041D12Sequence652000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es623010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041F22Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es637010737 (18)sp|P31600|NFRA_ECOLIe-116Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041H13Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es672010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041J01Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es648010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF043C03Sequence626000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es641010737 (18)sp|P31600|NFRA_ECOLIe-114Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF043L17Sequence623000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF045H04Sequence610000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF046D16Sequence473000016 (73)sp|P77214|CUSF_ECOLI4e-48Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es468010737 (18)sp|P31600|NFRA_ECOLI3e-82Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047H10Sequence607000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es584010737 (18)sp|P31600|NFRA_ECOLIe-105Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047H21Sequence601000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-114Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047J05Sequence607000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es603010737 (18)sp|P31600|NFRA_ECOLIe-109Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF048L21Sequence476000016 (73)sp|P77214|CUSF_ECOLI1e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es414010737 (18)sp|P31600|NFRA_ECOLI4e-71Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049D24Sequence643000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es646010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049L16Sequence645000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es620010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049P12Sequence590000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es602010737 (18)sp|P31600|NFRA_ECOLIe-110Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF050L20Sequence615000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es608010737 (18)sp|P31600|NFRA_ECOLIe-106Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041H13+ TGGTTTACTGCTGACGTCTTT
                      ____________________________________________________________
consensus TGGTTTACTGCTGACGTCTTT
 
. : . : . : . : . : . :
rJMFF049D24+ AGTACCAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF045H04+ CGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF047H21+ CGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF041F22+ GCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF043L17+ CGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF043C03+ CAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF049L16+ CGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF049P12+ GCTGGGGCTGAG
rJMFF047J05+ AGCTGGGGCTGAG
rJMFF041D12+ TATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF041D05+ CGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF041H13+ ATTGAGTACCAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF041J01+ AGTACCAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
rJMFF050L20+ CAGAAGAGCTGGGGCTGAG
rJMFF041D11+ AGTACCAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
                      ____________________________________________________________
consensus ATTGAGTACCAGCGCACTCGCAGACAATATCGGCACCAGCGCAGAAGAGCTGGGGCTGAG
 
. : . : . : . : . : . :
rJMFF049D24+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF045H04+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF047H21+ CGATNATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041F22+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF043L17+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF043C03+ CGATNATCGCCATTTGNTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF049L16+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF049P12+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF047J05+ CGATNATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041D12+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041D05+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041H13+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041J01+ CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF050L20+ CGATTATCGCCATT-TGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF041D11+ CGATTATCGCCATTNTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
rJMFF047H10+ GTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
                      ____________________________________________________________
consensus CGATTATCGCCATTTTGTTATTTATCCCCGTCTCGATAAAGCGCTGAAGGCACAGAAAAA
 
. : . : . : . : . : . :
rJMFF049D24+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF045H04+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF047H21+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041F22+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF043L17+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF043C03+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF049L16+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF049P12+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF047J05+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041D12+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041D05+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041H13+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041J01+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF050L20+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF041D11+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
rJMFF047H10+ TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
                      ____________________________________________________________
consensus TAACGACGAAGCAACCGCCATCCGCGAATTTGAATATATACACCAGCAGGTGCCGGATAA
 
. : . : . : . : . : . :
rJMFF049D24+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF045H04+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF047H21+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF041F22+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF043L17+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF043C03+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF049L16+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF049P12+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF047J05+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF041D12+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF041D05+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF041H13+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF041J01+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF050L20+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF046D16+ TTCCGCTGACTTTATACCTGNCGGAAGCCTATCGCCATTTCGGTCATGATGACCGGGC
rJMFF048L21+ GGGC
rJMFF041D11+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
rJMFF047H10+ TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
                      ____________________________________________________________
consensus TATTCCGCTGACTTTATACCTTGCGGAAGCCTATCGCCATTTTGGTCATGATGACCGGGC
 
. : . : . : . : . : . :
rJMFF049D24+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF045H04+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF047H21+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041F22+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF043L17+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF043C03+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF049L16+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF049P12+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF047J05+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041D12+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041D05+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041H13+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041J01+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF050L20+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF046D16+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF048L21+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF041D11+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
rJMFF047H10+ GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
                      ____________________________________________________________
consensus GCGGCTGTTGCTTGAGGATCAACTGAAACGTCACCCAGGAGATGCCCGACTTGAGCGCAG
 
. : . : . : . : . : . :
rJMFF049D24+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF045H04+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF047H21+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041F22+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF043L17+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF043C03+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF049L16+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF049P12+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF047J05+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041D12+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041D05+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041H13+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041J01+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF050L20+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF046D16+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF048L21+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF041D11+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
rJMFF047H10+ TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
                      ____________________________________________________________
consensus TCTGGCGGCTATTCCGGTTGAAGTGAAAAGCGTTACGACAGTTGAAGAACTGCTTGCCCA
 
. : . : . : . : . : . :
rJMFF049D24+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF045H04+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF047H21+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041F22+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF043L17+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF043C03+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF049L16+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF049P12+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF047J05+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041D12+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041D05+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041H13+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041J01+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF050L20+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF046D16+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF048L21+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF041D11+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
rJMFF047H10+ GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
                      ____________________________________________________________
consensus GCAAAAAGCGTGCGATGCTGCGCCGACCCTGCGTTGTCGCAGTGAAGTCGGGCAGAATGC
 
. : . : . : . : . : . :
rJMFF049D24+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF045H04+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF047H21+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041F22+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF043L17+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF043C03+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF049L16+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF049P12+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF047J05+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041D12+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041D05+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041H13+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041J01+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF050L20+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF046D16+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF048L21+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF041D11+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
rJMFF047H10+ CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
                      ____________________________________________________________
consensus CCTGCGGCTGGCACAGTTACCTGTCGCCAGAGCGCAACTGAACGATGCGACGTTTGCTGC
 
. : . : . : . : . : . :
rJMFF049D24+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF045H04+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF047H21+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041F22+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF043L17+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF043C03+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF049L16+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF049P12+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF047J05+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041D12+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041D05+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041H13+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041J01+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF050L20+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF046D16+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF048L21+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF041D11+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
rJMFF047H10+ ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
                      ____________________________________________________________
consensus ATCGCCGGAAGGAAAAACGCTGCGAACCGATCTGCTGCAACGGGCAATCTACCTGAAACA
 
. : . : . : . : . : . :
rJMFF049D24+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF045H04+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF047H21+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041F22+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF043L17+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF043C03+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF049L16+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF049P12+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF047J05+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041D12+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041D05+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041H13+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041J01+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF050L20+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF046D16+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF048L21+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF041D11+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
rJMFF047H10+ ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
                      ____________________________________________________________
consensus ATGGTCCCAGGCAGATACGCTATACAATGAAGCACGCCAGCAGAACACATTAAGCGCGGC
 
. : . : . : . : . : . :
rJMFF049D24+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF045H04+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF047H21+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF041F22+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF043L17+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF043C03+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF049L16+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF049P12+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF047J05+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF041D12+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF041D05+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAG
rJMFF041H13+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATCG
rJMFF041J01+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATCG
rJMFF050L20+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF046D16+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF048L21+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATC
rJMFF041D11+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATCG
rJMFF047H10+ AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATCGGATCCGGCC
                      ____________________________________________________________
consensus AGAACGCCGTCAGTGGTTTGACGTGCTTCTTGCCGGGCAGCTGGACGATCGGATCCGGCC