Previous Contig 010731:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047G14Sequence354002017 (2)gb:AP003573_18311001e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P052269010731 (4)gb:AY065068_15662224e-04Arabidopsis thaliana AT4g37250/C7A10_110 mRNA, complete cds.>gb:BT002237_1635840
JMFS047D01Sequence626010731 (4)pir|T00502|T005022e-49probable receptor-like protein kinase At2g23300 [imported] - Arabidopsis thalian
JMFS065D12Sequence623010731 (4)pir|T00502|T005022e-68probable receptor-like protein kinase At2g23300 [imported] - Arabidopsis thalian
JMSF036G23Sequence652002017 (2)gb:AY065068_15662227e-53Arabidopsis thaliana AT4g37250/C7A10_110 mRNA, complete cds.>gb:BT002237_1635840574010731 (4)pir|T00502|T005026e-33probable receptor-like protein kinase At2g23300 [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS065D12- GAACTCCGAGAGCGACGACAGCGAGGAGCCGGAGAAGAGTCACCCACCAGC
                      ____________________________________________________________
consensus GAACTCCGAGAGCGACGACAGCGAGGAGCCGGAGAAGAGTCACCCACCAGC
 
. : . : . : . : . : . :
JMFS065D12- GGCGCAGAAAACAGGGGAGTTGGTGACGGTGGACGGCGAGAAAGAGCTGGAGTTAGAGAC
                      ____________________________________________________________
consensus GGCGCAGAAAACAGGGGAGTTGGTGACGGTGGACGGCGAGAAAGAGCTGGAGTTAGAGAC
 
. : . : . : . : . : . :
JMFS065D12- TCTGCTGAAAGCGTCGGCGTATATTCTGGGCGCCAGCGGCTCCAGCATAATGTACAAGAC
                      ____________________________________________________________
consensus TCTGCTGAAAGCGTCGGCGTATATTCTGGGCGCCAGCGGCTCCAGCATAATGTACAAGAC
 
. : . : . : . : . : . :
JMFS065D12- GGTGTTGGACGACGGCACCGCCTTGGCCGTCCGCCGCGTCGGCGAGAGCGGCCTGGACCG
                      ____________________________________________________________
consensus GGTGTTGGACGACGGCACCGCCTTGGCCGTCCGCCGCGTCGGCGAGAGCGGCCTGGACCG
 
. : . : . : . : . : . :
JMFS065D12- GTTCCGGGAATTCGAGAACCAGATCCGGGTTATCAGCAAGCTGGTTCACCCGAATCTGGT
                      ____________________________________________________________
consensus GTTCCGGGAATTCGAGAACCAGATCCGGGTTATCAGCAAGCTGGTTCACCCGAATCTGGT
 
. : . : . : . : . : . :
JMFS065D12- TCGGATTCGTGGCTTTTACTGGGGCGCCGATGAAAAACTTGTCATCTACGATTTCGTTCC
                      ____________________________________________________________
consensus TCGGATTCGTGGCTTTTACTGGGGCGCCGATGAAAAACTTGTCATCTACGATTTCGTTCC
 
. : . : . : . : . : . :
JMFS065D12- CAATGGCAGCCTCGCCAATGCATGTCACAGAAAAGGCGGGTCTTCCCATCGTCATCTTCC
                      ____________________________________________________________
consensus CAATGGCAGCCTCGCCAATGCATGTCACAGAAAAGGCGGGTCTTCCCATCGTCATCTTCC
 
. : . : . : . : . : . :
JMFS065D12- GTGGGAGGTGCGGCTAAAGATAGCAAGAGGGGTGGCGCGTGGGCTGAGCTACATTCATGA
                      ____________________________________________________________
consensus GTGGGAGGTGCGGCTAAAGATAGCAAGAGGGGTGGCGCGTGGGCTGAGCTACATTCATGA
 
. : . : . : . : . : . :
JMFS065D12- GAAGAAGCACGTGCATGGGAATCTGAAGCCCAGCAACATCCTACTGGACGCCGATATGGA
JMFS047D01- GAAGAAGCACGTGCATGGGAATCTGAAGCCCAGCAACATCCTACTGGACGCCGATATGGA
                      ____________________________________________________________
consensus GAAGAAGCACGTGCATGGGAATCTGAAGCCCAGCAACATCCTACTGGACGCCGATATGGA
 
. : . : . : . : . : . :
JMFS065D12- GCCCAAGGTCGGCGATTTCGGGCTCGAACGCCTCGTCGTCGCCGGCGGCGAAAGCAGCCG
JMFS047D01- GCCCAAGGTCGGCGATTTCGGGCTCGAACGCCTCGTCGTCGCCGGCGGCGAAAGCAGCCG
rJMSF036G23+ GGCGGCGAAAGCAGCCG
                      ____________________________________________________________
consensus GCCCAAGGTCGGCGATTTCGGGCTCGAACGCCTCGTCGTCGCCGGCGGCGAAAGCAGCCG
 
. : . : . : . : . : . :
JMFS065D12- CAAGGTTTACGGCTCCTCCCGGAACTTCGGCA
JMFS047D01- CAAGGTTTACGGCTCCTCCCGGAACTTCGGCAGCAAGAGATCCACGGCGTCCCGCGATAG
rJMSF036G23+ CAAGGTTTACGGCTCCTCCCGGAACTTCGGCAGCAAGAGATCCACGGCGTCCCGCGATAG
                      ____________________________________________________________
consensus CAAGGTTTACGGCTCCTCCCGGAACTTCGGCAGCAAGAGATCCACGGCGTCCCGCGATAG
 
. : . : . : . : . : . :
JMFS047D01- CTTCCCGGATTCTGCAGTTTCCGGCGGGCACACTCCCAGCCCGAGCCCTAGCGCGTTAGG
rJMSF036G23+ CTTCCCGGATTCTGCAGTTTCCGGCGGGCACACTCCCAGCCCGAGCCCTAGCGCGTTAGG
                      ____________________________________________________________
consensus CTTCCCGGATTCTGCAGTTTCCGGCGGGCACACTCCCAGCCCGAGCCCTAGCGCGTTAGG
 
. : . : . : . : . : . :
JMFS047D01- AATATCGCCCTACATTGCACCCGAATCGCTCCGGAGTCTCAAGCCTAACCCGAAGTGGGA
rJMSF036G23+ AATATCGCCCTACATTGCACCCGAATCGCTCCGGAGTCTCAAGCCTAACCCGAAGTGGGA
                      ____________________________________________________________
consensus AATATCGCCCTACATTGCACCCGAATCGCTCCGGAGTCTCAAGCCTAACCCGAAGTGGGA
 
. : . : . : . : . : . :
JMFS047D01- CGTTTTCTCCTTCGGAGTGGTGCTGCTGGAGCTGCTGACCGGAAAAATCATTGTTTCCGA
rJMSF036G23+ CGTTTTCTCCTTCGGAGTGGTGCTGCTGGAGCTGCTGACCGGAAAAATCATTGTTTCCGA
                      ____________________________________________________________
consensus CGTTTTCTCCTTCGGAGTGGTGCTGCTGGAGCTGCTGACCGGAAAAATCATTGTTTCCGA
 
. : . : . : . : . : . :
JMFS047D01- TGAGATGGTGCCCGGGCCGCCCGTGATGGGAGTTGAGGAGAAGAGCAAGGTACTGAGAAT
rJMSF036G23+ TGAGATGGTGCCCGGGCCGCCCGTGATGGGAGTTGAGGAGAAGAGCAAGGTACTGAGAAT
                      ____________________________________________________________
consensus TGAGATGGTGCCCGGGCCGCCCGTGATGGGAGTTGAGGAGAAGAGCAAGGTACTGAGAAT
 
. : . : . : . : . : . :
JMFS047D01- GGCTGACGTGGCGATCCGTGCTGACATGGAAGGGAAAGAGGAAT-CCCTGTTGGAACTTC
rJMSF036G23+ GGCTGACGTGGCGATCCGTGCTGACATGGAAGGGAAAGAGGAAT-CCCTGTTGGAACTTC
rJMFF047G14+ GGGAAAGAGGAATCCCCTGTTGGAACTTC
                      ____________________________________________________________
consensus GGCTGACGTGGCGATCCGTGCTGACATGGAAGGGAAAGAGGAAT-CCCTGTTGGAACTTC
 
. : . : . : . : . : . :
JMFS047D01- TAAAATTAGGTTATAATTGTATATCTCCAGTCCCTCAAAAGAGACCTACCATGAAAGAGG
rJMSF036G23+ TAAAATTAGGTTATAATTGTATATCTCCAGTCCCTCAAAAGAGACCTACCATGAAAGAGG
rJMFF047G14+ TAAAATTAGGTTATAATNGTATATCTCCAGTCCCTCAAAAGAGACCTACCATGAAAGAGG
                      ____________________________________________________________
consensus TAAAATTAGGTTATAATTGTATATCTCCAGTCCCTCAAAAGAGACCTACCATGAAAGAGG
 
. : . : . : . : . : . :
JMFS047D01- TAGTTCAAGCACTTGACAACATTCCAACATCCTCGTCTTCTTCTTCATCCTACTTTTACA
rJMSF036G23+ TAGTTCAAGCACTTGACAACATTCCAACATCCTCGTCTTCTTCTTCATCCTACTTTTACA
rJMFF047G14+ TAGTTCAAGCACTTGACAACATTCCAACATCCTCGTCTTCTTCTTCATCCTACTTTTACA
                      ____________________________________________________________
consensus TAGTTCAAGCACTTGACAACATTCCAACATCCTCGTCTTCTTCTTCATCCTACTTTTACA
 
. : . : . : . : . : . :
JMFS047D01- GTCTTTAACAATATAAAAAATGTACCA
rJMSF036G23+ GTCTTTAACAATATAAAAAATGTACCAATTTGTAGTCACAACGCCACATGTACGTATGGT
rJMFF047G14+ GTCTTTAACAATATAAAAAATGTACCAATTTGTAGTCACAACGCCACATGTACGTATGGT
                      ____________________________________________________________
consensus GTCTTTAACAATATAAAAAATGTACCAATTTGTAGTCACAACGCCACATGTACGTATGGT
 
. : . : . : . : . : . :
rJMSF036G23+ TGATTATTAACATCTCCA
rJMFF047G14+ TGATTATTAACATCTCCATCTGCTAGATAATTTTTTAATAATATTACACGTATTCCTACC
                      ____________________________________________________________
consensus TGATTATTAACATCTCCATCTGCTAGATAATTTTTTAATAATATTACACGTATTCCTACC