Previous Contig 010727:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032I15Sequence596002014 (2)gb:AK118789_18167497e-60Arabidopsis thaliana At2g41710 mRNA for putative AP2 domain transcription factor708010727 (2)gb:AY088118_15731411e-18Arabidopsis thaliana clone 41462 mRNA, complete sequence.
JMFF047F13Sequence634002014 (2)gb:AY088118_15731413e-66Arabidopsis thaliana clone 41462 mRNA, complete sequence.601010727 (2)gb:AK118789_18167494e-14Arabidopsis thaliana At2g41710 mRNA for putative AP2 domain transcription factor

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032I15+ GAGGATACTGGTA
                      ____________________________________________________________
consensus GAGGATACTGGTA
 
. : . : . : . : . : . :
rJMFF032I15+ ATGAAGCTTCAGAATTGGCAGTTCAGCCAACTGAACCNTATGAGATGCCACGTCTGGGCT
                      ____________________________________________________________
consensus ATGAAGCTTCAGAATTGGCAGTTCAGCCAACTGAACCNTATGAGATGCCACGTCTGGGCT
 
. : . : . : . : . : . :
rJMFF032I15+ TGTCACAAAAAGGAAAAAGTCATAAAAGCTCCACAACTTCTGCTATGAGCATTTTGTCAC
rJMFF047F13+ C
                      ____________________________________________________________
consensus TGTCACAAAAAGGAAAAAGTCATAAAAGCTCCACAACTTCTGCTATGAGCATTTTGTCAC
 
. : . : . : . : . : . :
rJMFF032I15+ AATGTGCAGCTTACAAGAATTTGCAAGAGAAGGTAGCAAAGAAGAAAGAAAAAGTTGAGA
rJMFF047F13+ AATGTGCAGCTTACAAGAATTTGCAAGAGAAGGTAGCAAAGAAGAAAGAAAAAGTTGAGA
                      ____________________________________________________________
consensus AATGTGCAGCTTACAAGAATTTGCAAGAGAAGGTAGCAAAGAAGAAAGAAAAAGTTGAGA
 
. : . : . : . : . : . :
rJMFF032I15+ ATGATGAGAATGAAAACAAAAATACTATCAACAAAATTGATTATGGGAAGACAATTGAGA
rJMFF047F13+ ATGATGAGAATGAAAACAAAAATACTATCAACAAAATTGATTATGGGAAGACAATTGAGA
                      ____________________________________________________________
consensus ATGATGAGAATGAAAACAAAAATACTATCAACAAAATTGATTATGGGAAGACAATTGAGA
 
. : . : . : . : . : . :
rJMFF032I15+ AATCAATACATGATGCTGGAAATGAGAGGCTTGGAGCTTTATTTGGAAGTAGTGTAGGAT
rJMFF047F13+ AATCAATACATGATGCTGGAAATGAGAGGCTTGGAGCTTTATTTGGAAGTAGTGTAGGAT
                      ____________________________________________________________
consensus AATCAATACATGATGCTGGAAATGAGAGGCTTGGAGCTTTATTTGGAAGTAGTGTAGGAT
 
. : . : . : . : . : . :
rJMFF032I15+ TAACAATCAACAGAAACATCCACCCGCTCACTCCTATCTTGTCCGCTCCCCTACTAACCA
rJMFF047F13+ TAACAATCAACAGAAACATCCACCCGCTCACTCCTATCTTGTCCGCTCCCCTACTAACCA
                      ____________________________________________________________
consensus TAACAATCAACAGAAACATCCACCCGCTCACTCCTATCTTGTCCGCTCCCCTACTAACCA
 
. : . : . : . : . : . :
rJMFF032I15+ ACTACAACAGCATAGATGCCTTAACAGACCCTGTTCTTTGGACGTCTCTTGTTCCTGTTT
rJMFF047F13+ ACTACAACAGCATAGATGCCTTAACAGACCCTGTTCTTTGGACGTCTCTTGTTCCTGTTT
                      ____________________________________________________________
consensus ACTACAACAGCATAGATGCCTTAACAGACCCTGTTCTTTGGACGTCTCTTGTTCCTGTTT
 
. : . : . : . : . : . :
rJMFF032I15+ TTCCTTCAGGATCTTCACGTGCTACTGAGGTCACAAAGCACGAGTCTGGTTCGGATTATA
rJMFF047F13+ TTCCTTCAGGATCTTCACGTGCTACTGAGGTCACAAAGCACGAGTCTGGTTCGGATTATA
                      ____________________________________________________________
consensus TTCCTTCAGGATCTTCACGTGCTACTGAGGTCACAAAGCACGAGTCTGGTTCGGATTATA
 
. : . : . : . : . : . :
rJMFF032I15+ CTTTTTTCCAGCAAGAAGACTGAATCTCTCATAAGATGAAAGTTGTTGCTACAGACTTAT
rJMFF047F13+ CTTTTTTCCAGCAAGAAGACTGAATCTCTCATAAGATGAAAGTTGTTGCTACAGACTTAT
                      ____________________________________________________________
consensus CTTTTTTCCAGCAAGAAGACTGAATCTCTCATAAGATGAAAGTTGTTGCTACAGACTTAT
 
. : . : . : . : . : . :
rJMFF032I15+ GGTGTCCATCTATGAGTTTAAGTTGTTGAAGGGTGGGCAAACACTAAATTTTCAGAAGGT
rJMFF047F13+ GGTGTCCATCTATGAGTTTAAGTTGTTGAAGGGTGGGCAAACACTAAATTTTCAGAAGGT
                      ____________________________________________________________
consensus GGTGTCCATCTATGAGTTTAAGTTGTTGAAGGGTGGGCAAACACTAAATTTTCAGAAGGT
 
. : . : . : . : . : . :
rJMFF032I15+ TTGTACTTTGTATAATTATAGCTTTTCCTGAATGTAAAATGGTGAGTTCCCTGAGATAAT
rJMFF047F13+ TTGTACTTTGTATAATTATAGCTTTTCCTGAATGTAAAATGGTGAGTTCCCTGAGATAAT
                      ____________________________________________________________
consensus TTGTACTTTGTATAATTATAGCTTTTCCTGAATGTAAAATGGTGAGTTCCCTGAGATAAT
 
. : . : . : . : . : . :
rJMFF032I15+ GGTTCCTGCATGTAGAAATGTAAAATAGCCGATGA
rJMFF047F13+ GGTTCCTGCATGTAGAAATGTAAAATAGCCGATGATGTTTATTTATTTATTTATTCTTCC
                      ____________________________________________________________
consensus GGTTCCTGCATGTAGAAATGTAAAATAGCCGATGATGTTTATTTATTTATTTATTCTTCC