Previous Contig 010724:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023G07Sequence433007406 (8)645010724 (4)gb:AP005012_18472744e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMFF045L07Sequence644007406 (8)gb:AE005173_8953477e-27Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC013430_153624010724 (4)gb:AP005012_18472743e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMFF047E20Sequence445007406 (8)418010724 (4)
JMSF041E16Sequence761007406 (8)gb:AE005173_8953474e-21Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC013430_153610010724 (4)gb:AP005012_18472741e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045L07+ TGGTGTGAAGCATTTCCA
rJMSF041E16+ TGGTGTGAAGCATTTCCA
rJMFF023G07+ TCGACAGGGGATTCGTTGGCGTATTACATGATTGGTGTGAAGCATTTCCA
                      ____________________________________________________________
consensus TCGACAGGGGATTCGTTGGCGTATTACATGATTGGTGTGAAGCATTTCCA
 
. : . : . : . : . : . :
rJMFF045L07+ ACTTACCCAAGAACGTATGATCTAGTCCATGCATACGGCCTTCTAACTCTCGAATCTGAG
rJMSF041E16+ ACTTACCCANGANCGTATGATCTAGTCCANGCATACGGCCTTCTAACTCTCGAATCTGAG
rJMFF023G07+ ACTTACCCAAGAACGTATGATCTAGTCCATGCATACGGCCTTCTAACTCTCGAATCTGAG
                      ____________________________________________________________
consensus ACTTACCCAAGAACGTATGATCTAGTCCATGCATACGGCCTTCTAACTCTCGAATCTGAG
 
. : . : . : . : . : . :
rJMFF045L07+ CAGCATAGCAGATGCGGGATGCTCGATCTGTTCATCGAGATAGACCGGTTAACTCGTCCC
rJMSF041E16+ CAGCATAGCAGATGCGGGATGCTCGATCTGTTCATCGAGATAGACCGGTTAACTCGTCCC
rJMFF023G07+ CAGCATAGCAGATGCGGGATGCTCGATCTGTTCATCGAGATAGACCGGTTAACTCGTCCC
                      ____________________________________________________________
consensus CAGCATAGCAGATGCGGGATGCTCGATCTGTTCATCGAGATAGACCGGTTAACTCGTCCC
 
. : . : . : . : . : . :
rJMFF045L07+ GAGGTGGATGGATTATCATACGCGACACAGTTCCCCTCGTAGATTTAGCAAGAGCTCACT
rJMSF041E16+ GAGG--GATGGATTATCATACGCGACACAGTTCCCCTCGTAGATTTAGCAAGAGCTCACT
rJMFF023G07+ GAGG--GATGGATTATCATACGCGACACAGTTCCCCTCGTAGATTTAGCAAGAGCTCACT
                      ____________________________________________________________
consensus GAGG--GATGGATTATCATACGCGACACAGTTCCCCTCGTAGATTTAGCAAGAGCTCACT
 
. : . : . : . : . : . :
rJMFF045L07+ CAACACGCCTGAAATGGGATGCTCGAGTTGTGGAGATCGAAAGCAATAGCGACGAGAAAC
rJMSF041E16+ CAACACGCCTGAAATGGGATGCTCGAGTTGTGGAGATCGAAAGCAATAGCGACGAGAAAC
rJMFF023G07+ CAACACGCCTGAAATGGGATGCTCGAGTTGTGGAGATCGAAAGCAATAGCGACGAGAAAC
                      ____________________________________________________________
consensus CAACACGCCTGAAATGGGATGCTCGAGTTGTGGAGATCGAAAGCAATAGCGACGAGAAAC
 
. : . : . : . : . : . :
rJMFF045L07+ TTTTAGTTTGCCAGAAACCCATCATTAAAAGACAAGCAAGCTAATTAAGCTAGAATCTGC
rJMSF041E16+ TTTTAGTTTGCCAGAAACCCATCATTAAAAGACANGCAAGCTAATTAAGCTAGAATCTGC
rJMFF023G07+ TTTTAGTTTGCCAGAAACCCATCATTAAAAGACAAGCAAGCTAATTAAGCTAGAATCTGC
rJMFF047E20+ TTAGTTTGCCAGAAACCCATCATTAAAAGACAAGCAAGCTAATTAAGCTAGAATCTGC
                      ____________________________________________________________
consensus TTTTAGTTTGCCAGAAACCCATCATTAAAAGACAAGCAAGCTAATTAAGCTAGAATCTGC
 
. : . : . : . : . : . :
rJMFF045L07+ AGGCTGTAGTATATATATATATATATACTCCATTTCCATTTTCTTGATCTGAACTAATGG
rJMSF041E16+ AGGCTGTAGTATATATATATATATATACTCCATTTCCATTTTCTTGATCTGAACTAATGG
rJMFF023G07+ AGGCTGTAGTATATATATATATATATACTCCATTTCCATTTTCTTGATCTGAACTAATGG
rJMFF047E20+ AGGCTGTAGTATATATATATATATATACTCCATTTCCATTTTCTTGATCTGAACTAATGG
                      ____________________________________________________________
consensus AGGCTGTAGTATATATATATATATATACTCCATTTCCATTTTCTTGATCTGAACTAATGG
 
. : . : . : . : . : . :
rJMFF045L07+ CGATATTATATTGTTCCACCAAAAGGATGGAATTCAAAGTTGTTTCTTCAAAACAAGGAT
rJMSF041E16+ CGATATTATATTGTTCCACCAAAAGGATGGAATTCAAAGTTGTTTCTTCAAAACAAGGAT
rJMFF023G07+ CGATATTATATTGTTCCACCAAAAGGATGGAATTCAAAGTTGTTTCTTCAAAACAAGGAT
rJMFF047E20+ CGATATTATATTGTTCCACCAAAAGGATGGAATTCAAAGTTGTTTCTTCAAAACAAGGAT
                      ____________________________________________________________
consensus CGATATTATATTGTTCCACCAAAAGGATGGAATTCAAAGTTGTTTCTTCAAAACAAGGAT
 
. : . : . : . : . : . :
rJMFF045L07+ GAATGAAGCAGAAGAACACAGAGCTATGGAGCCGTAAGGTCTGCATAGGATCATCCATGT
rJMSF041E16+ GAATGAAGCAGAAGAACACAGAGCTATGGAGCCGTAAGGTCTGCATAGGATCATCCATGT
rJMFF023G07+ GAATGAAGCAGAAGAACACAGAGCTATGGAGCCGTAAGGTCTGCATAGGATCATCCATGT
rJMFF047E20+ GAATGAAGCAGAAGAACACAGAGCTATGGAGCCGTAAGGTCTGCATAGGATCATCCATGT
                      ____________________________________________________________
consensus GAATGAAGCAGAAGAACACAGAGCTATGGAGCCGTAAGGTCTGCATAGGATCATCCATGT
 
. : . : . : . : . : . :
rJMFF045L07+ AATTACACATTGCAGCACAGATCTGTCAAGAAAACAATGGCGATCTCTCTGCAAGTTTTT
rJMSF041E16+ AATTACACATTGCAGCACAGATCTGTCAAGAAAACAATGGCGATCTCTCTGCAAGTTTTT
rJMFF023G07+ AATTACACATTGCAGCACAGATCTGTCAAGAAAACAATGGCGATCTCTCTGCAAGTTTTT
rJMFF047E20+ AATTACACATTGCAGCACAGATCTGTCAAGAAAACAATGGCGATCTCTCTGCAAGTTTTT
                      ____________________________________________________________
consensus AATTACACATTGCAGCACAGATCTGTCAAGAAAACAATGGCGATCTCTCTGCAAGTTTTT
 
. : . : . : . : . : . :
rJMFF045L07+ ACATTGTGAAGAACTGGAGATGTTAAAGAATAAGGGAATTGCAATTTGCTT
rJMSF041E16+ ACATTGTGAAGAACTGGAGATGTTAAAGAATAAGGGAATTGCAATTTGCTT
rJMFF023G07+ ACATTGTGAAGAACTGGAGATGTTAAAGAATAAGGGAATTGCAATTTGCTT
rJMFF047E20+ ACATTGTGAAGAACTGGAGATGTTAAAGAATAAGGGAATTGCAATTTGCTTTACTATATA
                      ____________________________________________________________
consensus ACATTGTGAAGAACTGGAGATGTTAAAGAATAAGGGAATTGCAATTTGCTTTACTATATA
 
. : . : . : . : . : . :
rJMFF047E20+ TATTAAAGCTGGAGATGCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TATTAAAGCTGGAGATGCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG