Previous Contig 010720:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047E04Sequence414005074 (3)gb:AP003709_18322527e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN383010720 (5)
JMFS169E06Sequence269010720 (5)
JMSF009G22Sequence288005074 (3)787010720 (5)gb:AB024033_15157802e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AC069474_154
JMSF028E05Sequence627005074 (3)gb:AY140051_15824911e-42Arabidopsis thaliana CTP synthase-like protein (At4g02120) mRNA, complete cds.732010720 (5)gb:AB024033_15157805e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AC069474_154
JMSF046B12Sequence652020336gb:AY140051_1582491e-105Arabidopsis thaliana CTP synthase-like protein (At4g02120) mRNA, complete cds.610010720 (5)gb:AY140051_15824915e-05Arabidopsis thaliana CTP synthase-like protein (At4g02120) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009G22+ ATCAAAGACACATA
                      ____________________________________________________________
consensus ATCAAAGACACATA
 
. : . : . : . : . : . :
rJMSF009G22+ TGGGCAGCACCATGAGGCTGGTTCTCGGAAGACATTGTTCCGGTCTCCTGATTGCATCAC
rJMSF028E05+ TGATTGCATCAC
                      ____________________________________________________________
consensus TGGGCAGCACCATGAGGCTGGTTCTCGGAAGACATTGTTCCGGTCTCCTGATTGCATCAC
 
. : . : . : . : . : . :
rJMSF009G22+ TGCAAAGCTGTACAAGAATTCACAGTATGTGGATGAGAGGCATCGGCATAGATATGAGGT
rJMSF028E05+ TGCAAAGCTGTACAAGAATTCACAGTATGTGGATGAGAGGCATCGGCATAGATATGAGGT
                      ____________________________________________________________
consensus TGCAAAGCTGTACAAGAATTCACAGTATGTGGATGAGAGGCATCGGCATAGATATGAGGT
 
. : . : . : . : . : . :
rJMSF009G22+ TAATCCTGAGATGGTTGGTGCTTTAGAACAAGCTGGCTTGAAATTTGTTGGAACGGATGA
rJMSF028E05+ TAATCCTGAGATGGTTGGTGCTTTAGAACAAGCTGGCNTGAAATTTGTNGGAACGGATGA
                      ____________________________________________________________
consensus TAATCCTGAGATGGTTGGTGCTTTAGAACAAGCTGGCTTGAAATTTGTTGGAACGGATGA
 
. : . : . : . : . : . :
rJMSF009G22+ AAGTGGAAAGCGAATGGAGATTTTGGAACTTCCAAATCACCCATTTTATGTATGTGTCCA
rJMSF028E05+ AAGTGGAAAGCGAATGGAGATTTTGGAACTTCCAAATCACCCATTTTATGTATGTGTCCA
rJMSF046B12+ CCATTTTATGTATGTGTCCA
                      ____________________________________________________________
consensus AAGTGGAAAGCGAATGGAGATTTTGGAACTTCCAAATCACCCATTTTATGTATGTGTCCA
 
. : . : . : . : . : . :
rJMSF009G22+ GTTTCATCCAGAATTCAAGTCACGGCCTGGGAGGCCCTCAGCTCCA-TTTTTGGGTTTTA
rJMSF028E05+ GTTTCATCCAGAATTCAAGTCACGGCCTGGGAGGCCCTCAGCTCCA-TTTTTGGGTTTTA
rJMSF046B12+ GTTTCATCCAGAATTCAAGTCACGGCCTGGGAGGCCCTCAGCTCCATTTTTTGGGTTTTA
                      ____________________________________________________________
consensus GTTTCATCCAGAATTCAAGTCACGGCCTGGGAGGCCCTCAGCTCCA-TTTTTGGGTTTTA
 
. : . : . : . : . : . :
rJMSF009G22+ TCTTGGCTGCGATAGGGAAATTAGATGCACACTTCAAGAAGGGTCTTCAGAATGGAACGC
rJMSF028E05+ TCTTGGCTGCGATAGGGAAATTAGANGCACACTTCAAGAAGGGTCTTCAGAATGGAACGC
rJMSF046B12+ TCTTGGCTGCGATAGGGAAATTAGATGCACACTTCAAGAAGGGTCTTCAGAATGGAACGC
                      ____________________________________________________________
consensus TCTTGGCTGCGATAGGGAAATTAGATGCACACTTCAAGAAGGGTCTTCAGAATGGAACGC
 
. : . : . : . : . : . :
rJMSF009G22+ TATAGCAACGTCATTATTCAGTACTAGGGAAATCCTGTTATGTGCGGTTTGATACACTCA
rJMSF028E05+ TATAGCAACGTCATTATTCAGTACTAGGGAAATCCTGTTATGTGCGGTTTGATACACTCA
rJMSF046B12+ TATAGCAACGTCATTATTCAGTACTAGGGAAATCCTGTTATGTGCGGTTTGATACACTCA
                      ____________________________________________________________
consensus TATAGCAACGTCATTATTCAGTACTAGGGAAATCCTGTTATGTGCGGTTTGATACACTCA
 
. : . : . : . : . : . :
rJMSF009G22+ AGACAAATGTAAATTTTCTTTTAGGAGGCTTGTTGAAGAAAGGGAAAACGTGGAAATTTT
rJMSF028E05+ AGACAAANGTAAATTTTCTTTTAGGAGGCTTGTTGAAGAAAGGGAAAACGTGGAAATTTT
rJMSF046B12+ AGACAAATGTAAATTTTCTTTTAGGAGGCTTGTTGAAGAAAGGGAAAACGTGGAAATTTT
                      ____________________________________________________________
consensus AGACAAATGTAAATTTTCTTTTAGGAGGCTTGTTGAAGAAAGGGAAAACGTGGAAATTTT
 
. : . : . : . : . : . :
rJMSF009G22+ GGCTCGCTGCTGTTAACAAAGATGCATACCGATACAAGCTGCTTCATGTTGGTTGGGCTT
rJMSF028E05+ GGCTCGCTGCTGTTAACAAAGATGCATACCGATACAAGCTGCTTCATGTTGGTTGGGCTT
JMFS169E06- GCTTCATGTTGGTTGGGCTT
rJMSF046B12+ GGCTCGCTGCTGTTAACAAAGATGCATACCGATACAAGCTGCTTCATGTTGGTTGGGCTT
rJMFF047E04+ AGCTGCTTCATGTTGGTTGGGCTT
                      ____________________________________________________________
consensus GGCTCGCTGCTGTTAACAAAGATGCATACCGATACAAGCTGCTTCATGTTGGTTGGGCTT
 
. : . : . : . : . : . :
rJMSF009G22+ TCAGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATTAT
rJMSF028E05+ TCAGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATTAT
JMFS169E06- T-AGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATTAT
rJMSF046B12+ TCAGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATTAT
rJMFF047E04+ TCAGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATNAT
                      ____________________________________________________________
consensus TCAGGGTGCTGCTTCTGATGGTTGTTTCTGGCGAAAGCAGAAAACATTATATATAATTAT
 
. : . : . : . : . : . :
rJMSF009G22+ ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATTTGGTTTCCTTCAAAATTCA
rJMSF028E05+ ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATNTGGTTTCCTTCAAAATTCA
JMFS169E06- ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATTTGGTTTCCTTCAAAATTCA
rJMSF046B12+ ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATTTGGTTTCCTTCAAAATTCA
rJMFF047E04+ ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATTTGGTTTCCTTCAAAATTCA
                      ____________________________________________________________
consensus ATATGTTTTGTATTACAGATTTAGAGTGTACGTTGCCCATTTGGTTTCCTTCAAAATTCA
 
. : . : . : . : . : . :
rJMSF009G22+ AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGAGATGGC
rJMSF028E05+ AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGAGATGGC
JMFS169E06- AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGACATGGC
rJMSF046B12+ AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGAGATGGC
rJMFF047E04+ AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGAGATGGC
                      ____________________________________________________________
consensus AATTCGTCTGTGTTTCAAGCGAGTGATATGTAGGATTGTTTGGCTGATATTAGAGATGGC
 
. : . : . : . : . : . :
rJMSF009G22+ AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATA
rJMSF028E05+ AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATATGGAAG
JMFS169E06- AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATATGGAAG
rJMSF046B12+ AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATATGGAAG
rJMFF047E04+ AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATATGGAAG
                      ____________________________________________________________
consensus AAAGTTAGATAGAAAATTTTCATGATATGCAATTTTGAGTTGCTCTATAATATATGGAAG
 
. : . : . : . : . : . :
rJMSF028E05+ A
JMFS169E06- AC
rJMSF046B12+ ACCATGGCTTTAAATGTCGAATGGTCAACATTTTTT
rJMFF047E04+ A-CATGGCTTTAAATGTCGAATGGTCAACATTTTTTTCCCTTTTTCAAAAAAGAAATGAC
                      ____________________________________________________________
consensus ACCATGGCTTTAAATGTCGAATGGTCAACATTTTTTTCCCTTTTTCAAAAAAGAAATGAC
 
. : . : . : . : . : . :
rJMFF047E04+ GAATTGTCAAGTGTCCXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GAATTGTCAAGTGTCCNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG