Previous Contig 010719:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O09Sequence479006572 (19)pir|A84473|A844735e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294653010719 (19)pir|A84473|A844733e-50probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF004O12Sequence517006572 (19)pir|A84473|A844734e-23probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294635010719 (19)pir|A84473|A844732e-55probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF014O15Sequence510006572 (19)pir|A84473|A844735e-23probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294712010719 (19)pir|A84473|A844731e-68probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF019D14Sequence584006572 (19)pir|A84473|A844735e-27probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294714010719 (19)pir|A84473|A844735e-71probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF028J09Sequence569006572 (19)pir|A84473|A844731e-45probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294588010719 (19)pir|A84473|A844736e-56probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF028N06Sequence390010719 (19)pir|A84473|A844739e-21probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294346010719 (19)pir|A84473|A844739e-21probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF034N23Sequence441006572 (19)pir|A84473|A844731e-13probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294490010719 (19)pir|A84473|A844731e-38probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF037L08Sequence567006572 (19)pir|A84473|A844733e-25probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294521010719 (19)pir|A84473|A844733e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF037N20Sequence492006572 (19)pir|A84473|A844733e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294750010719 (19)pir|A84473|A844736e-53probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF041J20Sequence643006572 (19)pir|A84473|A844734e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294616010719 (19)pir|A84473|A844734e-47probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF047E01Sequence497006572 (19)pir|A84473|A844731e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294503010719 (19)pir|A84473|A844735e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFN028I09Sequence604010719 (19)pir|A84473|A844737e-76probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS058D12Sequence627010719 (19)pir|A84473|A844731e-88probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS103F12Sequence138010719 (19)gb:AP005570_18542312e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ13
JMFS108G11Sequence520010719 (19)pir|A84473|A844733e-40probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS135E11Sequence572010719 (19)pir|A84473|A844732e-60probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS168D02Sequence615010719 (19)pir|A84473|A844732e-46probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMSF028F14Sequence669006572 (19)pir|A84473|A844734e-40probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294742010719 (19)pir|A84473|A844734e-83probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS058D12- GGACAGCCACA
                      ____________________________________________________________
consensus GGACAGCCACA
 
. : . : . : . : . : . :
JMFS058D12- TGATGCCGGCGGTGGCCGTGGGGCGGAAAATGGGGGACGCGATAAGGGAGTACGTGAAGA
                      ____________________________________________________________
consensus TGATGCCGGCGGTGGCCGTGGGGCGGAAAATGGGGGACGCGATAAGGGAGTACGTGAAGA
 
. : . : . : . : . : . :
JMFS058D12- CGGCTAAAAATCCCACGGCGGCGCTCAGCTTTGGAGGGACGGTGGTGAACGTGAAGCCGT
                      ____________________________________________________________
consensus CGGCTAAAAATCCCACGGCGGCGCTCAGCTTTGGAGGGACGGTGGTGAACGTGAAGCCGT
 
. : . : . : . : . : . :
JMFS058D12- CGCCGGTGGTGGCGGCTTTCAGCTCAAGAGGGCCCAATACGGTGACTCCTCAGATCTTGA
                      ____________________________________________________________
consensus CGCCGGTGGTGGCGGCTTTCAGCTCAAGAGGGCCCAATACGGTGACTCCTCAGATCTTGA
 
. : . : . : . : . : . :
JMFS058D12- AGCCCGACGTGATCGGGCCGGGTGTGAATATTTTGGCTGCTTGGTCTCTGGCAATCGGGC
                      ____________________________________________________________
consensus AGCCCGACGTGATCGGGCCGGGTGTGAATATTTTGGCTGCTTGGTCTCTGGCAATCGGGC
 
. : . : . : . : . : . :
JMFS058D12- CCACTGGGCTTGTTGCGGACTCCAGGAGGACTCCTTTCAACATCATGTCTGGAACATCCA
JMFS103F12- AACATCATGTCTGGAACATCCA
JMFN028I09- CTGGGCTTGTTGCGGACTCCAGGAGGACTCCTTT-AACATCATGTCTGGAACATCCA
                      ____________________________________________________________
consensus CCACTGGGCTTGTTGCGGACTCCAGGAGGACTCCTTTCAACATCATGTCTGGAACATCCA
 
. : . : . : . : . : . :
JMFS058D12- TGTCTTGTCCCCATATAAGTGGGCTAGCAGCTCTGCTCAAAGCAGCTCACCCAGAATGGA
JMFS103F12- TGTCTTGTCCCCATATAAGTGGGCTAGCAGCTCTGCTCAAAGCAGCTCACCCAGAATGGA
JMFN028I09- TGTCTTGTCCCCATATAAGTGGGCTAGCAGCTCTGCTCAAAGCAGCTCACCCAGAATGGA
rJMSF028F14+ CCCCATATAAGTGGGCTAGCAGCTCTGCTCAAAGCAGCTCACCCAGAATGGA
rJMFF037N20+ GGCTAGCAGCTNTGNTCAAAGCAGCTCACCCAGAATGGA
                      ____________________________________________________________
consensus TGTCTTGTCCCCATATAAGTGGGCTAGCAGCTCTGCTCAAAGCAGCTCACCCAGAATGGA
 
. : . : . : . : . : . :
JMFS058D12- GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGACAACACCAAC-
JMFS103F12- GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGA
JMFN028I09- GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGACAACACCAAC-
rJMSF028F14+ GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGACAACACCAAC-
rJMFF037N20+ GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGACAACACCAACT
rJMFF019D14+ GGGGCAATCAAGTCTGCANTAATGACAACAGCATACACCCATGACAACACCAAC-
rJMFF014O15+ TAATGACAACAGCATACACCCATGACAACACCAAC-
                      ____________________________________________________________
consensus GCCCAGGGGCAATCAAGTCTGCACTAATGACAACAGCATACACCCATGACAACACCAAC-
 
. : . : . : . : . : . :
JMFS058D12- TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
JMFN028I09- TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
rJMSF028F14+ TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
rJMFF037N20+ TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
rJMFF019D14+ TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
rJMFF004O12+ GGACGCTGGAGGAGACGAACTTTCCAACCCCGTGGGCTCACGGGTCGGG
rJMFF002O09+ TCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
rJMFF028J09+ GGG
JMFS135E11- CGCTGGTGGTGACGAACTTT-CAA-CCCGTGGGCTCACGGGTCGGG
rJMFF014O15+ TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
                      ____________________________________________________________
consensus TCCCCCATTCGGGACGCTGGAGGAGACGAACTTTCCAA-CCCGTGGGCTCACGGGTCGGG
 
. : . : . : . : . : . :
JMFS058D12- CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
JMFN028I09- CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMSF028F14+ CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMFF037N20+ CCATGTCGACCCCCACAAGGGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMFF019D14+ CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMFF004O12+ CCATGTCGACCCCCACAA-GGCCCTCTCCCCGGGGCCTGGTCTACGACATTGCCCCAACT
rJMFF002O09+ CCATGTCGACCCCCACAA-GGCCCTCTCCCCGGGGCCTGGTCTACGACATTGCCCCAACT
rJMFF028J09+ CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
JMFS135E11- CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMFF014O15+ CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
rJMFF041J20+ ACGACATTGCCCCAACT
JMFS168D02+ ACATTGCCCCAACT
                      ____________________________________________________________
consensus CCATGTCGACCCCCACAA-GGCCCTCTCCCC-GGGCCTGGTCTACGACATTGCCCCAACT
 
. : . : . : . : . : . :
JMFS058D12- GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCANATCCAGGCCATTGTC
JMFN028I09- GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMSF028F14+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF037N20+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF019D14+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF004O12+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF002O09+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF028J09+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
JMFS135E11- GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF014O15+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF041J20+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
rJMFF034N23+ CTCAGCAAATCCAGGCCATTGTC
rJMFF037L08+ CCATGTTCTTGTGCTCCNTAGANTATACTACTCAGCAAATCCAGGCCATTGTC
JMFS168D02+ GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
JMFS108G11- CAGCAAATCCAGGCCATTGTC
                      ____________________________________________________________
consensus GACTATACCATGTTCTTGTGCTCCCTAGACTATACTACTCAGCAAATCCAGGCCATTGTC
 
. : . : . : . : . : . :
JMFS058D12- AAGGCACCAAACATCACCTG
JMFN028I09- AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMSF028F14+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF037N20+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF019D14+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF004O12+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF002O09+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF028J09+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
JMFS135E11- AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF014O15+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF041J20+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF034N23+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAANTACCCG
rJMFF037L08+ AAGGCACCAAACATCACCTGTGCCAAGAANCTATCCAATCCCGCCCAGCTCAANTACCCG
JMFS168D02+ AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
JMFS108G11- AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
rJMFF047E01+ ATCCCGCCCAGCTCAACTACCCG
                      ____________________________________________________________
consensus AAGGCACCAAACATCACCTGTGCCAAGAAACTATCCAATCCCGCCCAGCTCAACTACCCG
 
. : . : . : . : . : . :
JMFN028I09- TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATTGTACGCCAAACCAGGGAACTCACCAAT
rJMSF028F14+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF037N20+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF019D14+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF004O12+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF002O09+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF028J09+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
JMFS135E11- TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF014O15+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF041J20+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF034N23+ TCTTTCTNGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF037L08+ TCTTTNTCGGTCCTGTNTGGAAAATCAAGAATCGTNCGCCAAACCAGGGAACTCACCAAT
JMFS168D02+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
JMFS108G11- TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
rJMFF047E01+ TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
                      ____________________________________________________________
consensus TCTTTCTCGGTCCTGTTTGGAAAATCAAGAATCGTACGCCAAACCAGGGAACTCACCAAT
 
. : . : . : . : . : . :
JMFN028I09- GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMSF028F14+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF037N20+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF019D14+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF004O12+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF002O09+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF028J09+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
JMFS135E11- GTGGGAGCCGCAGGAACCTTGTACGAGGTATCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF014O15+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF041J20+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF034N23+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATNGAAGCGCCACCATCTGTAACGGTG
rJMFF037L08+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATNGAAGCGCCNCCATCTGTAACGGTG
rJMFF028N06+ TGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
JMFF028N06- TGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
JMFS168D02+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
JMFS108G11- GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
rJMFF047E01+ GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
                      ____________________________________________________________
consensus GTGGGAGCCGCAGGAACCTTGTACGAGGTAGCCATCGAAGCGCCACCATCTGTAACGGTG
 
. : . : . : . : . : . :
JMFN028I09- ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMSF028F14+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF037N20+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF019D14+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF004O12+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF002O09+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF028J09+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
JMFS135E11- ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF014O15+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF041J20+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF034N23+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF037L08+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF028N06+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
JMFF028N06- ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
JMFS168D02+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
JMFS108G11- ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
rJMFF047E01+ ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
                      ____________________________________________________________
consensus ACAGTTAAGCCGACAAAGCTCGTTTTCAAGAACGTAGGCGACAGGTTGAGGTACACTGTC
 
. : . : . : . : . : . :
JMFN028I09- ACAT
rJMSF028F14+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF037N20+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF019D14+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF004O12+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF002O09+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF028J09+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
JMFS135E11- ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF014O15+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF041J20+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF034N23+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF037L08+ ACATTNGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF028N06+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
JMFF028N06- ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
JMFS168D02+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
JMFS108G11- ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
rJMFF047E01+ ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
                      ____________________________________________________________
consensus ACATTCGTGTCAAAGAAAGGCGTCGTTACGCCTAGCAATGCTGCATTTGGTTCCGTTTCT
 
. : . : . : . : . : . :
rJMSF028F14+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF037N20+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF019D14+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF004O12+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF002O09+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF028J09+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
JMFS135E11- TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF014O15+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF041J20+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF034N23+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF037L08+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF028N06+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
JMFF028N06- TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
JMFS168D02+ TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
JMFS108G11- TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
rJMFF047E01+ TGGAACAATGCCCAGAACCAAGTAAGAAGTCCGATCGCTTTCTCATGGACACAGCTGTTT
                      ____________________________________________________________
consensus TGGAACAATGCCCAGAACCAAGTAAGAAGCCCGATCGCTTTCTCATGGACACAGCTGTTT
 
. : . : . : . : . : . :
rJMSF028F14+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF037N20+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF019D14+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF004O12+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF002O09+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF028J09+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
JMFS135E11- TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTA
rJMFF014O15+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF041J20+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF034N23+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF037L08+ TAACTNTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF028N06+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
JMFF028N06- TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
JMFS168D02+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
JMFS108G11- TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
rJMFF047E01+ TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
                      ____________________________________________________________
consensus TAACTTTGCTAGCTAGGGAGCTTTAACCTTGTAAGAATCAGTCTGTGCTAATGTAATTTT
 
. : . : . : . : . : . :
rJMSF028F14+ CGGGTGCGATGAAAATATATCTGAAAATCAAAAC
rJMFF037N20+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACA
rJMFF019D14+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATG
rJMFF004O12+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAA
rJMFF002O09+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACA-GGAATA
rJMFF028J09+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAA
rJMFF014O15+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
rJMFF041J20+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
rJMFF034N23+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAA
rJMFF037L08+ NGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAAT
rJMFF028N06+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAA
JMFF028N06- CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
JMFS168D02+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
JMFS108G11- CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
rJMFF047E01+ CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
                      ____________________________________________________________
consensus CGGGTGCGATGAAAATATATCTGAAAATCAAAACCTAAGGGAGGAAATGAACATGGAATA
 
. : . : . : . : . : . :
rJMFF002O09+ AAGA
rJMFF014O15+ AAGATTATGAT
rJMFF041J20+ AAGATTATGATTGAA
JMFF028N06- AAGATTATGATTGAA
JMFS168D02+ AAGATTATGATTGAA
JMFS108G11- AAGATTATGATTGAATTCC
rJMFF047E01+ AAGATTATGATTGAATTCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAGATTATGATTGAATTCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG