Previous Contig 010718:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009I08Sequence687010718 (2)gb:AK176482_18184705e-05Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-28-L12.
JMFF047D24Sequence616015049gb:AK176482_18184701e-26Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-28-L12.597010718 (2)gb:AK176482_18184700.049Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-28-L12.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009I08+ CCGCA
                      ____________________________________________________________
consensus CCGCA
 
. : . : . : . : . : . :
rJMFF009I08+ GAAGCGGCGGCGGCTTTTTTCCCGCTATCAGAGTCCAGCGCGAGATTCGGCGGCTCAGCT
                      ____________________________________________________________
consensus GAAGCGGCGGCGGCTTTTTTCCCGCTATCAGAGTCCAGCGCGAGATTCGGCGGCTCAGCT
 
. : . : . : . : . : . :
rJMFF009I08+ GGCGGCGGCGGCGGCTCNTCGTCCAGACGCACCAAGTCATTCGCTAGCCCGATGTTCATG
                      ____________________________________________________________
consensus GGCGGCGGCGGCGGCTCNTCGTCCAGACGCACCAAGTCATTCGCTAGCCCGATGTTCATG
 
. : . : . : . : . : . :
rJMFF009I08+ CGATCATCAGGCGCGCCAAACGGCTTCTTCTCATCCAGCCGGCTAAGAAGCGGCGACCCC
rJMFF047D24+ ATCATCAGGCGCGCCAAACGGTTT-TTCTCATCCAGCCGGTTAAGAAGCGGCGACCCC
                      ____________________________________________________________
consensus CGATCATCAGGCGCGCCAAACGGTTTCTTCTCATCCAGCCGGTTAAGAAGCGGCGACCCC
 
. : . : . : . : . : . :
rJMFF009I08+ GAAGCCCTACTATCACCGGACAGATTCAACCGGCGGTGAGCACGTGGGACATGAAAATTA
rJMFF047D24+ GAAGCCCTACTATCACCGGACAGATTCAACCGGCGGTGAGCACGTGGGACATGAAAATTA
                      ____________________________________________________________
consensus GAAGCCCTACTATCACCGGACAGATTCAACCGGCGGTGAGCACGTGGGACATGAAAATTA
 
. : . : . : . : . : . :
rJMFF009I08+ AATGATCATCGGGAAGCGCACAGTACTGGGTGATCCACGGAGCTTGAGCGGGTCGGGTGG
rJMFF047D24+ AATGATCATCGGGAAGCGCACAGTACTGGGTGATCCACGGAGCTTGAGCGGGTCGGGTGG
                      ____________________________________________________________
consensus AATGATCATCGGGAAGCGCACAGTACTGGGTGATCCACGGAGCTTGAGCGGGTCGGGTGG
 
. : . : . : . : . : . :
rJMFF009I08+ GGACATATTCGGGTGATATTAATGGCGAAAATTAATGAGTTGCCTGGCTACACCTATGGG
rJMFF047D24+ GGACATATTCGGGTGATATTAATGGCGAAAATTAATGAGTTGCCTGGCTACACCTATGGG
                      ____________________________________________________________
consensus GGACATATTCGGGTGATATTAATGGCGAAAATTAATGAGTTGCCTGGCTACACCTATGGG
 
. : . : . : . : . : . :
rJMFF009I08+ TCATTCTGGCGCTCATTAAATGGCAGGCCGGAGAAAATGGTGTAAGAAAAGGAAATGCAG
rJMFF047D24+ TCATTTTGGCGCTCATTAAATGGCAGGCCGGAGAAAATGGTGTAAGAAAAGGAAATGCAG
                      ____________________________________________________________
consensus TCATTTTGGCGCTCATTAAATGGCAGGCCGGAGAAAATGGTGTAAGAAAAGGAAATGCAG
 
. : . : . : . : . : . :
rJMFF009I08+ TTATGGCATTTAATGGGGAATTGACTACTGATGCCATTAGCCTCAGATGATGTATCGAAT
rJMFF047D24+ TTATGGCATTTAATGGGGAATTGACTACTGATGCCATTAGCCTCAGATGATGTATCGAAT
                      ____________________________________________________________
consensus TTATGGCATTTAATGGGGAATTGACTACTGATGCCATTAGCCTCAGATGATGTATCGAAT
 
. : . : . : . : . : . :
rJMFF009I08+ TGCATAAAGGGATATATAGTGGGGGAAGTGATGATTAAGGTGATCAAAGCTGCATTGGTC
rJMFF047D24+ TGCATAAAGGGATATATAGTGGGGGAAGTGATGATTAAGGTGATCAAAGCTGCATTGGTC
                      ____________________________________________________________
consensus TGCATAAAGGGATATATAGTGGGGGAAGTGATGATTAAGGTGATCAAAGCTGCATTGGTC
 
. : . : . : . : . : . :
rJMFF009I08+ ATTTTTTTGTTGGATTTATGTGGGCATTCTTTTTAGCTTTTTGGGGCACCAAGATTATGG
rJMFF047D24+ ATTTTTTTGTTGGATTTATGTGGGCATTCTTTTTAGCTTTTTGGGGCACCAAGATTATGG
                      ____________________________________________________________
consensus ATTTTTTTGTTGGATTTATGTGGGCATTCTTTTTAGCTTTTTGGGGCACCAAGATTATGG
 
. : . : . : . : . : . :
rJMFF009I08+ TGTGACCGATTTGAATGTGTACTTTGTTTGGNTTTGGTTCGTGGGAATATGGTGTGGATC
rJMFF047D24+ TGTGACCGATTTGAATGTGTACTTTGTTTGGTTTTGGTTCGTGGGAATATGGTGTGGATC
                      ____________________________________________________________
consensus TGTGACCGATTTGAATGTGTACTTTGTTTGGTTTTGGTTCGTGGGAATATGGTGTGGATC
 
. : . : . : . : . : . :
rJMFF009I08+ ACCCAATAGCAACCCAGACAAT
rJMFF047D24+ ACCCAATAGCAACCCAGACAATTGTTAGTGATGATTTAACAGCTAAAAAAAAAAAAAAAG
                      ____________________________________________________________
consensus ACCCAATAGCAACCCAGACAATTGTTAGTGATGATTTAACAGCTAAAAAAAAAAAAAAAG