Previous Contig 010717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I15Sequence613000147 (5)gb:AY088570_15735878e-46Arabidopsis thaliana clone 7925 mRNA, complete sequence.782010717 (3)gb:AY088570_1573587e-112Arabidopsis thaliana clone 7925 mRNA, complete sequence.
JMFF047D23Sequence612000147 (5)gb:AY088570_15735878e-59Arabidopsis thaliana clone 7925 mRNA, complete sequence.638010717 (3)gb:AY088570_15735874e-48Arabidopsis thaliana clone 7925 mRNA, complete sequence.
JMSF045G01Sequence710000147 (5)gb:AY088570_15735877e-66Arabidopsis thaliana clone 7925 mRNA, complete sequence.819010717 (3)gb:AY088570_15735877e-97Arabidopsis thaliana clone 7925 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003I15+ AAGNCAAAGATCATGGTGATTAAAGATGTCGAGAG
                      ____________________________________________________________
consensus AAGNCAAAGATCATGGTGATTAAAGATGTCGAGAG
 
. : . : . : . : . : . :
rJMFF003I15+ AGATGAAATTGAGTTCATCACAAAGACTTTGAATTGCTTGCCCATTGCAAATGTTGAGCA
rJMSF045G01+ TGCAAATGTTGAGCA
                      ____________________________________________________________
consensus AGATGAAATTGAGTTCATCACAAAGACTTTGAATTGCTTGCCCATTGCAAATGTTGAGCA
 
. : . : . : . : . : . :
rJMFF003I15+ TTTCAGGGCAGAGAAACTAGGACATGCAGATTTGGTTGAGGAGGTATCACTTGGAGATGG
rJMSF045G01+ TTTCAGGGCAGAGAAACTAGGACATGCAGATTTGGTTGAGGAGGTATCACTTGGAGATGG
                      ____________________________________________________________
consensus TTTCAGGGCAGAGAAACTAGGACATGCAGATTTGGTTGAGGAGGTATCACTTGGAGATGG
 
. : . : . : . : . : . :
rJMFF003I15+ TGGGAAGATTGTGAAGATTACTGGAATTCAGGATATGGGTAGAACTGCATCTGTGCTGGT
rJMSF045G01+ TGGGAAGATTGTGAAGATTACTGGAATTCAGGATATGGGTAGAACTGCATCTGTGCTGGT
                      ____________________________________________________________
consensus TGGGAAGATTGTGAAGATTACTGGAATTCAGGATATGGGTAGAACTGCATCTGTGCTGGT
 
. : . : . : . : . : . :
rJMFF003I15+ TCGAGGGTCCAATCAGTTGGTTATTGATGAAGCTGAGAGGAGTTTGCACGATGCCTTGTG
rJMSF045G01+ TCGAGGGTCCAATCAGTTGGTTATTGATGAAGCTGAGAGGAGTTTGCACGATGCCTTGTG
                      ____________________________________________________________
consensus TCGAGGGTCCAATCAGTTGGTTATTGATGAAGCTGAGAGGAGTTTGCACGATGCCTTGTG
 
. : . : . : . : . : . :
rJMFF003I15+ TGTTGTTAGATGTTTGGTGAGTAAGAGGTTCTTGATTGCAGGTGGTGGGGCACCGGAGAT
rJMSF045G01+ TGTTGTTAGATGTTTGGTGAGTAAGAGGTTCTTGATTGCAGGTGGTGGGGCACCGGAGAT
                      ____________________________________________________________
consensus TGTTGTTAGATGTTTGGTGAGTAAGAGGTTCTTGATTGCAGGTGGTGGGGCACCGGAGAT
 
. : . : . : . : . : . :
rJMFF003I15+ AGAGCTTTCAAGACAGTTGGGTGCATGGGCAAAGGTTTTACAAGGGATGGAGGGTTACTG
rJMSF045G01+ AGAGCTTTCAAGACAGTTGGGTGCATGGGCAAAGGTTTTACAAGGGATGGAGGGTTACTG
rJMFF047D23+ GCATGGGCAAAGGTTTTACAAGGGATGGAGGGTTACTG
                      ____________________________________________________________
consensus AGAGCTTTCAAGACAGTTGGGTGCATGGGCAAAGGTTTTACAAGGGATGGAGGGTTACTG
 
. : . : . : . : . : . :
rJMFF003I15+ TGTGAAATCATTTGCTGAATCTCTTGAGGTTATTCCTTATACATTAGCTGAGAATGCTGG
rJMSF045G01+ TGTGAAATCATTTGCTGAATCTCTTGAGGTTATTCCTTATACATTAGCTGAGAATGCTGG
rJMFF047D23+ TGTGAAATCATTTGCTGAATCTCTTGAGGTTATTCCTTATACATTAGCTGAGAATGCTGG
                      ____________________________________________________________
consensus TGTGAAATCATTTGCTGAATCTCTTGAGGTTATTCCTTATACATTAGCTGAGAATGCTGG
 
. : . : . : . : . : . :
rJMFF003I15+ ACTGAACCCTATAACTATTGTGACCGAGTTAAGGAATAGGCATGCACAGGGTGAGATCAA
rJMSF045G01+ ACTGAACCCTATAACTATTGTGACCGAGTTAAGGAATAGGCATGCACAGGGTGAGATCAA
rJMFF047D23+ ACTGAACCCTATAACTATTGTGACCGAGTTAAGGAATAGGCATGCACAGGGTGAGATCAA
                      ____________________________________________________________
consensus ACTGAACCCTATAACTATTGTGACCGAGTTAAGGAATAGGCATGCACAGGGTGAGATCAA
 
. : . : . : . : . : . :
rJMFF003I15+ TGCTGGGATCAATGTGAGGAAGGGGCAGATCACTAACATTTTGGAGGAGAATGTAGTGCA
rJMSF045G01+ TGCTGGGATCAATGTGAGGAAGGGGCAGATCACTAACATTTTGGAGGAGAATGTAGTGCA
rJMFF047D23+ TGCTGGGATCAATGTGAGGAAGGGGCAGATCACTAACATTTTGGAGGAGAATGTAGTGCA
                      ____________________________________________________________
consensus TGCTGGGATCAATGTGAGGAAGGGGCAGATCACTAACATTTTGGAGGAGAATGTAGTGCA
 
. : . : . : . : . : . :
rJMFF003I15+ GCCACTCCTTGTGAGCACAAGTGCGATTTCCTTGGCCACTGAATGTGTGCGAATGATTTT
rJMSF045G01+ GCCACTCCTTGTGAGCACAAGTGCGATTTCCTTGGCCACTGAATGTGTGCGAATGATTTT
rJMFF047D23+ GCCACTCCTTGTGAGCACAAGTGCGATTTCCTTGGCCACTGAATGTGTGCGAATGATTTT
                      ____________________________________________________________
consensus GCCACTCCTTGTGAGCACAAGTGCGATTTCCTTGGCCACTGAATGTGTGCGAATGATTTT
 
. : . : . : . : . : . :
rJMFF003I15+ GAAAATCGATGATATTGTTACTGTGAGGTAGATTGGATTGTACTTGAAAGTGGTGGACAA
rJMSF045G01+ GAAAATCGATGATATTGTTACTGTGAGGTAGATTGGATTGTACTTGAAAGTGGTGGACAA
rJMFF047D23+ GAAAATCGATGATATTGTTACTGTGAGGTAGATTGGATTGTACTTGAAAGTGGTGGACAA
                      ____________________________________________________________
consensus GAAAATCGATGATATTGTTACTGTGAGGTAGATTGGATTGTACTTGAAAGTGGTGGACAA
 
. : . : . : . : . : . :
rJMFF003I15+ AGAGATAAGTTTTTCTGGTGTCTTTCTATTATTACTTGTGTGTTAAACTTTTAAATGTTT
rJMSF045G01+ AGAGATAAGTTTTTCTGGTGTCTTTCTATTATTACTTGTGTGTTAAACTTTTAAATGTTT
rJMFF047D23+ AGAGATAAGTTTTTCTGGTGTCTTTCTATTATTACTTGTGTGTTAAACTTTTAAATGTTT
                      ____________________________________________________________
consensus AGAGATAAGTTTTTCTGGTGTCTTTCTATTATTACTTGTGTGTTAAACTTTTAAATGTTT
 
. : . : . : . : . : . :
rJMFF003I15+ CTTTGTTGAACTTGAGATCGGTGCTCT
rJMSF045G01+ CTTTGTTGAACTTGAGATCGGTGCTCTGTTGGTTAATTTTACATAGTTGCTTCCTAGAAT
rJMFF047D23+ CTTTGTTGAACTTGAGATCGGTGCTCTGTTGGTTAATTTTACATAGTTGCTTCCTAGAAT
                      ____________________________________________________________
consensus CTTTGTTGAACTTGAGATCGGTGCTCTGTTGGTTAATTTTACATAGTTGCTTCCTAGAAT
 
. : . : . : . : . : . :
rJMSF045G01+ CTTTCGCTTGGTTGAGTGTGTAGTTTTAACGTATGGTTCTGATATTCATACAGCTTTGAA
rJMFF047D23+ CTTTCGCTTGGTTGAGTGTGTAGTTTTAACGTATGGTTCTGATATTCATACAGCTTTGAA
                      ____________________________________________________________
consensus CTTTCGCTTGGTTGAGTGTGTAGTTTTAACGTATGGTTCTGATATTCATACAGCTTTGAA
 
. : . : . : . : . : . :
rJMSF045G01+ TTAGTTCTTTA
rJMFF047D23+ TTAGTTCTTTAGCTGTACGATTTATGTTTATTTAATCAAGTTTCTGGTTTATGAAGTCTG
                      ____________________________________________________________
consensus TTAGTTCTTTAGCTGTACGATTTATGTTTATTTAATCAAGTTTCTGGTTTATGAAGTCTG
 
. : . : . : . : . : . :
rJMFF047D23+ AAACCAGTATTTCTTGGCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAACCAGTATTTCTTGGCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG