Previous Contig 010712:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028E24Sequence499010712 (4)pir|B96792|B967922e-32hypothetical protein F14G6.4 [imported] - Arabidopsis thaliana>gb:AE005173_89517751010712 (4)pir|B96792|B967924e-32hypothetical protein F14G6.4 [imported] - Arabidopsis thaliana>gb:AE005173_89517
JMFF047D07Sequence642010712 (4)pir|B96792|B967923e-32hypothetical protein F14G6.4 [imported] - Arabidopsis thaliana>gb:AE005173_89517631010712 (4)pir|B96792|B967921e-12hypothetical protein F14G6.4 [imported] - Arabidopsis thaliana>gb:AE005173_89517

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF028E24- TG
JMFF047D07- TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
JMFF028E24- ACTTCTTGACTCCGGCTCTCTCATCGTCTCCGACTAGCGACGCGTTTCCTTTACTAGGAA
JMFF047D07- ACTTCTTGACTCCGGCTCTCTCATCGTCTCCGACTAGCGACGCGTTTCCTTTACTAGGAA
                      ____________________________________________________________
consensus ACTTCTTGACTCCGGCTCTCTCATCGTCTCCGACTAGCGACGCGTTTCCTTTACTAGGAA
 
. : . : . : . : . : . :
JMFF028E24- TACTAGCGTCTTTACAGGGCTGGGATCATGAGTTCTCATCAACATGCAGAGCTCCCTCAA
JMFF047D07- TACTAGCGTCTTTACAGGGCTGGGATCATGAGTTCTCATCAACATGCAGAGCTCCCTCAA
rJMFF028E24+ CTCATCAACATGCAGAGCTCCNTCAA
                      ____________________________________________________________
consensus TACTAGCGTCTTTACAGGGCTGGGATCATGAGTTCTCATCAACATGCAGAGCTCCCTCAA
 
. : . : . : . : . : . :
JMFF028E24- GTAAAACCACTTGTAGCATTAAGTGGTACTGCAAAAGAAGGTGCCATTGGACCGACCCTT
JMFF047D07- GTAAAACCACTTGTAGCATTAAGTGGTACTGCAAAAGAAGGTGCCATTGGACCGACCCTT
rJMFF028E24+ GTAAAACCACTNGTAGCATTAAGTGGTACTGCAAAAGAAGGTGCCATTGGACCGACCCTT
                      ____________________________________________________________
consensus GTAAAACCACTTGTAGCATTAAGTGGTACTGCAAAAGAAGGTGCCATTGGACCGACCCTT
 
. : . : . : . : . : . :
JMFF028E24- GGTTTGATTGACATTGGTGAGAGCGAGTATGCTTACCTTTTCCAAGTGTCCCTTCCTGGA
JMFF047D07- GGTTTGATTGACATTGGTGAGAGCGAGTATGCTTACCTTTTCCAAGTGTCCCTTCCTGGA
rJMFF028E24+ GGTTTGATTGACATTGGTGAGAGCGAGTATGCTTACCTTTTCCAAGTGTCCCTTCCTGGA
                      ____________________________________________________________
consensus GGTTTGATTGACATTGGTGAGAGCGAGTATGCTTACCTTTTCCAAGTGTCCCTTCCTGGA
 
. : . : . : . : . : . :
JMFF028E24- GTAAGAGATAAAGGTAATTTAAAATGCGACATACAGAGAGATGGCAAAGTCCAGATAGAG
JMFF047D07- GTAAGAGATAAAGGTAATTTAAAATGCGACATACAGAGAGATGGCAAAGTCCAGATAGAG
rJMFF028E24+ GTAAGAGATAAAGGTAATTTAAAATGCGACATACAGAGAGATGGCAAAGTCCAGATAGAG
rJMFF047D07+ ACATACAGAGAGATGGCAAAGTCCAGATAGAG
                      ____________________________________________________________
consensus GTAAGAGATAAAGGTAATTTAAAATGCGACATACAGAGAGATGGCAAAGTCCAGATAGAG
 
. : . : . : . : . : . :
JMFF028E24- GGTATGATCTCAGAGTCTCAACTTTTAAAGAACGCCTCTGAAGTTTATCAAGTGAATGTA
JMFF047D07- GGTATGATCTCAGAGTCTCAACTTTTAAAGAACGCCTCTGAAGTTTATCAAGTGAATGTA
rJMFF028E24+ GGTATGATCTCAGAGTCTCAACTTTTAAAGAACGCCTCTGAAGTTTATCAAGTGAATGTA
rJMFF047D07+ GGTATGATCTCAGAGTCTCAAC-TTTAAAGAACGCCTCTGAAGTTTATCAAGTGAATGTA
                      ____________________________________________________________
consensus GGTATGATCTCAGAGTCTCAACTTTTAAAGAACGCCTCTGAAGTTTATCAAGTGAATGTA
 
. : . : . : . : . : . :
JMFF028E24- CAAGAGCTTTGCCCACCCGGACCATTCACCGTATCATTCAGTTTGCCAGGAGCAGTGGAT
JMFF047D07- CAAGAGCTTTGCCCACCCGGACCATTCACCGTATCATTCAGTTTGCCAGGAGCAGTGGAT
rJMFF028E24+ CAAGAGCTTTGCCCACCCGGACCATTCACCGTATCATTCAGTTTGCCAGGAGCAGTGGAT
rJMFF047D07+ CAAGAGCTTTGCCCACCCGGACCATTCACCGTATCATTCAGTTTGCCAGGAGCAGTGGAT
                      ____________________________________________________________
consensus CAAGAGCTTTGCCCACCCGGACCATTCACCGTATCATTCAGTTTGCCAGGAGCAGTGGAT
 
. : . : . : . : . : . :
JMFF028E24- CCCAGGCTATGTTCTCTAACATTCAGACAAGATGGTATTCTAGAAGTTGTCGTACTGAAG
JMFF047D07- CCCAGGCTATGTTCTCTAACATTCAGACAAGATGGTATTCTAGAAGTTGTCGTACTGAAG
rJMFF028E24+ CCCAGGCTATGTTCTCTAACATTCAGACAAGATGGTATTCTAGAAGTTGTCGTACTGAAG
rJMFF047D07+ CCCAGGCTATGTTCTCTAACATTCAGACAAGATGGTATTCTAGAAGTTGTCGTACTGAAG
                      ____________________________________________________________
consensus CCCAGGCTATGTTCTCTAACATTCAGACAAGATGGTATTCTAGAAGTTGTCGTACTGAAG
 
. : . : . : . : . : . :
JMFF028E24- TTTGGATTACCTCGGGT
JMFF047D07- TTTGGATTACCTCGGGTTTCAGCCGAAGGTTTGTCTGAAAATTGGTCCAATGGCTGGTTC
rJMFF028E24+ TTTGGATTACCTCGGGTTTCAGCCGAAGGTTTGTCTGAAAATTGGTCCAATGGCTGGTTC
rJMFF047D07+ TTTGGATTACCTCGGGTTTCAGCCGAAGGTTTGTCTGAAAATTGGTCCAATGGCTGGTTC
                      ____________________________________________________________
consensus TTTGGATTACCTCGGGTTTCAGCCGAAGGTTTGTCTGAAAATTGGTCCAATGGCTGGTTC
 
. : . : . : . : . : . :
JMFF047D07- CAACCTTCGTAACTGTAATCAGTGTTTAGGTATGTTTTCTTGATTATGGTCATAGGACAT
rJMFF028E24+ CAACCTTCGTAACTGTAATCAGTGTTTAGGTATGTTTTCTTGATTATGGTCATAGGACAT
rJMFF047D07+ CAACCTTCGTAACTGTAATCAGTGTTTAGGTATGTTTTCTTGATTATGGTCATAGGACAT
                      ____________________________________________________________
consensus CAACCTTCGTAACTGTAATCAGTGTTTAGGTATGTTTTCTTGATTATGGTCATAGGACAT
 
. : . : . : . : . : . :
JMFF047D07- TTAATTTAAAAACTGATGAAGGTGGTTGTAATCCTTGTTG
rJMFF028E24+ TTAATTTAAAAACTGATGAAGGTGGTTGTAATCCTTGTTGTGAAGAATGCGATAGAGTAA
rJMFF047D07+ TTAATTTAAAAACTGATGAAGGTGGTTGTAATCCTTGTTGTGAAGAATGCGATAGAGTAA
                      ____________________________________________________________
consensus TTAATTTAAAAACTGATGAAGGTGGTTGTAATCCTTGTTGTGAAGAATGCGATAGAGTAA
 
. : . : . : . : . : . :
rJMFF028E24+ GGTCAGACTCCCCAAAGTCTAGGTTCCACCCACGCTTCATTTTCCTATATATGCTACTCC
rJMFF047D07+ GGTCAGACTCCCCAAAGTCTAGGTTCCACCCACGCTTCATTTTCCTATATATGCTACTCC
                      ____________________________________________________________
consensus GGTCAGACTCCCCAAAGTCTAGGTTCCACCCACGCTTCATTTTCCTATATATGCTACTCC
 
. : . : . : . : . : . :
rJMFF028E24+ GTATATTGCTATTTACTAGCTGAATTATGGAAAATTGGATTTTGTACCATGACTACCATC
rJMFF047D07+ GTATATTGCTATTTACTAGCTGAATTATGGAAAATTGGATTTTGTACCATGACTACCATC
                      ____________________________________________________________
consensus GTATATTGCTATTTACTAGCTGAATTATGGAAAATTGGATTTTGTACCATGACTACCATC
 
. : . : . : . : . : . :
rJMFF028E24+ CCAAATTCGTTTGATTTCCGACATGCTTTCCTAGCTAGTAGATATCCATATATAGTTGTA
rJMFF047D07+ CCAAATTCGTTTGATTTCCGACATGCTTTCCTAGCTAGTAGATATCCATATATAGTTGTA
                      ____________________________________________________________
consensus CCAAATTCGTTTGATTTCCGACATGCTTTCCTAGCTAGTAGATATCCATATATAGTTGTA
 
. : . : . : . : . : . :
rJMFF028E24+ TTTTT
rJMFF047D07+ TTTTTTGTCACTTAACATATGCTTTTTTTGGTCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTTTTTGTCACTTAACATATGCTTTTTTTGGTCAAAAAAAAAAAAAAAACTCTCCAGGGT