Previous Contig 010710:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047D01Sequence634010710 (2)gb:SLY011914_17154334e-29Solanum lycopersicum mRNA for THY5 protein.450010710 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047D01- TGGCTCTTTTTTTTTCCCAGATCAATATACCACGTTTATCCTCTCTCTCTCTCTCTGT
                      ____________________________________________________________
consensus TGGCTCTTTTTTTTTCCCAGATCAATATACCACGTTTATCCTCTCTCTCTCTCTCTGT
 
. : . : . : . : . : . :
JMFF047D01- TTCTGTACATTTTCCGTTGTTTTGGAGGAAAATGCAGGAACAAGCTGCTACGAGTTCCAT
                      ____________________________________________________________
consensus TTCTGTACATTTTCCGTTGTTTTGGAGGAAAATGCAGGAACAAGCTGCTACGAGTTCCAT
 
. : . : . : . : . : . :
JMFF047D01- GGCTGCCAGTTCTCTTCCTTCAAGCAGCGAAAGATCTTCCAGCTCAGCTCTCCAGCCCGA
                      ____________________________________________________________
consensus GGCTGCCAGTTCTCTTCCTTCAAGCAGCGAAAGATCTTCCAGCTCAGCTCTCCAGCCCGA
 
. : . : . : . : . : . :
JMFF047D01- AGTTAAAGAAGGTGTGGAGAGTGATGATGAGAGCAGGAGAGTGCCTGAGATGGGTGGAGA
                      ____________________________________________________________
consensus AGTTAAAGAAGGTGTGGAGAGTGATGATGAGAGCAGGAGAGTGCCTGAGATGGGTGGAGA
 
. : . : . : . : . : . :
JMFF047D01- AGCCGCCGGTCCGGCTGCTTCAGGCCGGGATGGCACCTCTGCGGCGGGTCCCGTTCACCA
                      ____________________________________________________________
consensus AGCCGCCGGTCCGGCTGCTTCAGGCCGGGATGGCACCTCTGCGGCGGGTCCCGTTCACCA
 
. : . : . : . : . : . :
JMFF047D01- TTCCGCCGCCACTCAAAGGAAGAGGGGCAGAAGCCCAGCTGACAAAGAGAACAAGAGGTT
                      ____________________________________________________________
consensus TTCCGCCGCCACTCAAAGGAAGAGGGGCAGAAGCCCAGCTGACAAAGAGAACAAGAGGTT
 
. : . : . : . : . : . :
JMFF047D01- AAAAAGGTTGCTCTGAGGAACAGAGTTTCAGCACAGCAAGCAAGGGAGAGGAAGAAGGCA
                      ____________________________________________________________
consensus AAAAAGGTTGCTCTGAGGAACAGAGTTTCAGCACAGCAAGCAAGGGAGAGGAAGAAGGCA
 
. : . : . : . : . : . :
JMFF047D01- TATTTGATAGACTTGGAGGGAAGGGTGAAAGACTTGGAAACAAAGAATGCTGAGCTTGAA
                      ____________________________________________________________
consensus TATTTGATAGACTTGGAGGGAAGGGTGAAAGACTTGGAAACAAAGAATGCTGAGCTTGAA
 
. : . : . : . : . : . :
JMFF047D01- GAGAGGCTGTCCACCTTGCAAAATGAAAACCAGATGCTAAGACATATTCTGAAGAACACC
rJMFF047D01+ CAGATGTTAAGACATATTCTGAAGAACACC
                      ____________________________________________________________
consensus GAGAGGCTGTCCACCTTGCAAAATGAAAACCAGATGTTAAGACATATTCTGAAGAACACC
 
. : . : . : . : . : . :
JMFF047D01- ACTGCTGGCAGCCAGGAAGGGAGGAAATAGCTTACTGTCACCGAGACTTTGTGAAAGATT
rJMFF047D01+ ATTGTTGGCAGCCAGGAAGGGAGGAAATAGTTTACTGTCAAGGAGACTTTGTGAAGGATT
                      ____________________________________________________________
consensus ATTGTTGGCAGCCAGGAAGGGAGGAAATAGTTTACTGTCACGGAGACTTTGTGAAGGATT
 
. : . : . : . : . : . :
JMFF047D01- TGAGAGGTGAAAGTATGATGACATGTCTGATG
rJMFF047D01+ TGAGAGGTGAAAGTATGATGACATGTCTGATGTTTCTTTGCAGAGTTCAAGAACAGTGAT
                      ____________________________________________________________
consensus TGAGAGGTGAAAGTATGATGACATGTCTGATGTTTCTTTGCAGAGTTCAAGAACAGTGAT
 
. : . : . : . : . : . :
rJMFF047D01+ AGTTTGAAGTGAGGATTAGTTATTGTCATTATTGGCCTTTGTTGAAGTTGTTTATTGTTG
                      ____________________________________________________________
consensus AGTTTGAAGTGAGGATTAGTTATTGTCATTATTGGCCTTTGTTGAAGTTGTTTATTGTTG
 
. : . : . : . : . : . :
rJMFF047D01+ CTTGGGATGTTTTTTGCTTTTATATGAAGCAAGAATCCATGCTTTTTACATGCACTGGTA
                      ____________________________________________________________
consensus CTTGGGATGTTTTTTGCTTTTATATGAAGCAAGAATCCATGCTTTTTACATGCACTGGTA
 
. : . : . : . : . : . :
rJMFF047D01+ GCTCTTGGGATTTCCTTCAATTGCACATAAAGGATTAGCCATCAAAAAAGTTTGTGTTAT
                      ____________________________________________________________
consensus GCTCTTGGGATTTCCTTCAATTGCACATAAAGGATTAGCCATCAAAAAAGTTTGTGTTAT
 
. : . : . : . : . : . :
rJMFF047D01+ TGCCATGATTAACCCTCGGCAAGGTAAACCGCATTAGAAAGCCCTTGCATGATGGGGTTG
                      ____________________________________________________________
consensus TGCCATGATTAACCCTCGGCAAGGTAAACCGCATTAGAAAGCCCTTGCATGATGGGGTTG
 
. : . : . : . : . : . :
rJMFF047D01+ CCCAAGAAGATAATGACAAAAATCGATTCGGACTTTTTAGTATGTATAAGAATCTTGCTC
                      ____________________________________________________________
consensus CCCAAGAAGATAATGACAAAAATCGATTCGGACTTTTTAGTATGTATAAGAATCTTGCTC