Previous Contig 010709:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014E04Sequence821010709 (10)gb:AY258008_15932974e-74Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF017B04Sequence612002011 (11)gb:AF510035_18071602e-69Nicotiana tabacum ankyrin domain protein (ANK1) mRNA, complete cds.796010709 (10)gb:AY258008_15932974e-74Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF017C03Sequence142010709 (10)gb:AF510035_18071601e-16Nicotiana tabacum ankyrin domain protein (ANK1) mRNA, complete cds.
JMFF017N20Sequence696010709 (10)gb:AY258008_15932971e-72Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF030F02Sequence476002011 (11)gb:AY258007_15932963e-49Nicotiana tabacum TGB12K interacting protein 2 (TIP2) mRNA, complete cds.800010709 (10)gb:AY258008_15932971e-74Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF033E07Sequence781010709 (10)gb:AY258008_15932971e-74Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF037K14Sequence772010709 (10)gb:AY258008_15932973e-72Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.
JMFF043N02Sequence625002011 (11)gb:AF510035_18071602e-67Nicotiana tabacum ankyrin domain protein (ANK1) mRNA, complete cds.615010709 (10)gb:AX306545_14656398e-61Sequence 5 from Patent WO0188139.
JMFF047C20Sequence306002011 (11)gb:AF510035_18071600.024Nicotiana tabacum ankyrin domain protein (ANK1) mRNA, complete cds.262010709 (10)
JMSF022L15Sequence670002011 (11)gb:AY258008_15932973e-81Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.773010709 (10)gb:AY258008_15932971e-74Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017N20+ TCTGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
rJMSF022L15+ TCTGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
rJMFF033E07+ TCTGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
rJMFF030F02+ CTGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
rJMFF017B04+ GGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
rJMFF037K14+ TGGAAGAGATTGAGCAAGGGGGGTCCAGCTGCAATGAT
rJMFF014E04+ TGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
                      ____________________________________________________________
consensus TCTGGAAGAGATTGAGCAA-GGGGGTCCAGCTGCAATGAT
 
. : . : . : . : . : . :
rJMFF017N20+ GAGGTACTGGAATGNCAAAGANGTTNTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMSF022L15+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMFF033E07+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMFF030F02+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMFF017B04+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMFF037K14+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
rJMFF014E04+ GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
                      ____________________________________________________________
consensus GAGGTACTGGAATGACAAAGATGTTCTAAAGAAGTTGGGTGAAGCAATGGGTTTCCCAGG
 
. : . : . : . : . : . :
rJMFF017N20+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGANGAAGCAGAAGAAGCAAGTGA
rJMSF022L15+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAGCAGAAGAAGCAAGTGA
rJMFF033E07+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAGCAGAAGAAGCAAGTGA
rJMFF030F02+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAACAGAAGAAGCAAGTGA
rJMFF017B04+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAACAGAAGAAGCAAGTGA
rJMFF037K14+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAGCAGAAGAAGCAAGTGA
rJMFF043N02+ AGATGAAGCAGAAGAAGCAAGTGA
rJMFF014E04+ TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAGCAGAAGAAGCAAGTGA
                      ____________________________________________________________
consensus TGCAGGAGAGACAGCCACATCTGGTGAAACAGGTACAGATGAAGCAGAAGAAGCAAGTGA
 
. : . : . : . : . : . :
rJMFF017N20+ AGACGAATCAATTGTTCATCNCTGTGCCAGTGTTNGTGATGAAGAGGGCTTGAAGAATGC
rJMSF022L15+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF033E07+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF030F02+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF017B04+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF037K14+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF043N02+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
rJMFF014E04+ AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
                      ____________________________________________________________
consensus AGACGAATCAATTGTTCATCACTGTGCCAGTGTTGGTGATGAAGAGGGCTTGAAGAATGC
 
. : . : . : . : . : . :
rJMFF017N20+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMSF022L15+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF033E07+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF030F02+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF017B04+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF037K14+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF043N02+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
rJMFF017C03+ TGATAAAGATGAGGAAGATTCAGAGGGAAGNACGNCNCNGCATTT
rJMFF014E04+ ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
                      ____________________________________________________________
consensus ACTCGCTGCTGGTGCTGATAAAGATGAGGAAGATTCAGAGGGAAGGACGGCACTGCATTT
 
. : . : . : . : . : . :
rJMFF017N20+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMSF022L15+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF033E07+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF030F02+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF017B04+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF037K14+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF043N02+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
rJMFF017C03+ TGCNNGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTNGAGTCTGGGGCTAAGGT
rJMFF014E04+ TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
                      ____________________________________________________________
consensus TGCTTGTGGGTATGGGGAGGTGAAGTGTGCTCAGATTCTTCTCGAGTCTGGGGCTAAGGT
 
. : . : . : . : . : . :
rJMFF017N20+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMSF022L15+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF033E07+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF030F02+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF017B04+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF037K14+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF043N02+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
rJMFF017C03+ GGATGCTTTGGACAAGAATAAGAATNCTGCACTCCA
rJMFF014E04+ GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
                      ____________________________________________________________
consensus GGATGCTTTGGACAAGAATAAGAATACTGCACTCCACTATGCTGCTGGATACGGAAGAAA
 
. : . : . : . : . : . :
rJMFF017N20+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMSF022L15+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF033E07+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF030F02+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF017B04+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF037K14+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF043N02+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
rJMFF014E04+ GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
                      ____________________________________________________________
consensus GGAGTGTGTTGCGCTTCTTCTGGAGAATGGTGCTGCTGTCACTCTCCAAAATATGGATGG
 
. : . : . : . : . : . :
rJMFF017N20+ CAAGACACCCATCGAGGTTGCAAAACTCAATNACCAGAACGATGTCCTAAAGCTCCTTGA
rJMSF022L15+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF033E07+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF030F02+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF017B04+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF037K14+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF043N02+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
rJMFF014E04+ CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
                      ____________________________________________________________
consensus CAAGACACCCATCGAGGTTGCAAAACTCAATAACCAGAACGATGTCCTAAAGCTCCTTGA
 
. : . : . : . : . : . :
rJMFF017N20+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTANGAATTACGTACGCTCGAGTCTGTTG
rJMSF022L15+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF033E07+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF030F02+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF017B04+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF037K14+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF043N02+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
rJMFF014E04+ GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
                      ____________________________________________________________
consensus GAAGGATGCATTTCTATAAGCTGGAATGCACCTATGAATTACGTACGCTCGAGTCTGTTG
 
. : . : . : . : . : . :
rJMFF017N20+ GGTGTCAGCAGGGTGTGATTGTGTGTCTGGGCTTANGTAATCCTTTTTCGAAAATTGTTG
rJMSF022L15+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF033E07+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF030F02+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF017B04+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF037K14+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF043N02+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF014E04+ GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
rJMFF047C20+ TAATCCTTTTTGGAAAATTGCGG
                      ____________________________________________________________
consensus GGTGTCAG-AGGGTGTGATTGTGTGT-TGGGCTTATGTAATCCTTTTTCGAAAATTGTTG
 
. : . : . : . : . : . :
rJMFF017N20+ GCGAATGATTACATTCTGGTTCTTTGAGAATTATATCCCACGTAACCCTTTTTTATT
rJMSF022L15+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF033E07+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF030F02+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF017B04+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF037K14+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF043N02+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF014E04+ GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
rJMFF047C20+ GGGAATGATTCCATTCGGGTTTTTGGAGAATTATAT-CCATGTACCCCTTTTTTATTGGA
                      ____________________________________________________________
consensus GTGAATGATTACATTCTGGTTCTTTGAGAATTATAT-CCATGTAACCCTTTTTTATTCGA
 
. : . : . : . : . : . :
rJMSF022L15+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF033E07+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF030F02+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF017B04+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF037K14+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF043N02+ ATGAATGGTTTGTATTTGTAAAATCACAA
rJMFF014E04+ ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
rJMFF047C20+ ATGAATGGTTGGTATTTGTAAAATCACAATCACTGCCTTCCTTTTTTTTTAGGTTTTTTA
                      ____________________________________________________________
consensus ATGAATGGTTTGTATTTGTAAAATCACAATCACTGCCTTCCTTTTCTCTTAGGTTTTTTA
 
. : . : . : . : . : . :
rJMSF022L15+ GGTGGATGGACAGCTAT
rJMFF033E07+ GGTGGATGGACAGCTAT
rJMFF030F02+ GGTGGATGGACAGCTATTGCATTTCAATAAAC
rJMFF017B04+ GGTGGATGGACAGCTATTGCATTTCAATAAACTGTTCTCG
rJMFF037K14+ GGTGGATGGACAGCTAT
rJMFF014E04+ GGTGGATGGACAGCTATTGCATTTCAATAAACTGTTCTCGACATGCAAGATAAGATGC
rJMFF047C20+ GGGGGAGGGACAGCTATTGCATTTCAATAAACTGTTCTCGCCATGCAAGATAAGATGCXX
                      ____________________________________________________________
consensus GGTGGATGGACAGCTATTGCATTTCAATAAACTGTTCTCGCCATGCAAGATAAGATGCNN
 
. : . : . : . : . : . :
rJMFF047C20+ XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAAAAAAAAAAAAAAAACGC
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAAAAACGC