Previous Contig 010704:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025A07Sequence436001807 (126)gb:AY085669_15707364e-52Arabidopsis thaliana clone 16846 mRNA, complete sequence.519010704 (3)gb:AY075677_15678167e-05Arabidopsis thaliana AT5g58470/mqj2_60 mRNA, complete cds.>gb:AF367294_1791746 A
JMFF034I15Sequence371001534 (2)gb:AY463619_16077084e-10Arabidopsis thaliana TAF15b (TAF15b) mRNA, partial cds.703010704 (3)gb:AY075677_15678162e-49Arabidopsis thaliana AT5g58470/mqj2_60 mRNA, complete cds.>gb:AF367294_1791746 A
JMFF047B14Sequence576001807 (126)sp|P50248|SAHH_TOBAC7e-82Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc530010704 (3)gb:AY086517_15715654e-04Arabidopsis thaliana clone 25545 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF034I15+ CTCCATTAAAGGTCAAGCAATGTGATGAAAATTGTGGG
                      ____________________________________________________________
consensus CTCCATTAAAGGTCAAGCAATGTGATGAAAATTGTGGG
 
. : . : . : . : . : . :
rJMFF034I15+ GGATTCCTGTGACAACTCAAGAATCTATATCTCAAATTTGCCTCCTGATGTGACCGTTGA
                      ____________________________________________________________
consensus GGATTCCTGTGACAACTCAAGAATCTATATCTCAAATTTGCCTCCTGATGTGACCGTTGA
 
. : . : . : . : . : . :
rJMFF034I15+ TGAACTTAGAGAACTTTTTGGAAGCATCGGACAAGTTGCAAGAATTAAGCAAAAGCGTGG
                      ____________________________________________________________
consensus TGAACTTAGAGAACTTTTTGGAAGCATCGGACAAGTTGCAAGAATTAAGCAAAAGCGTGG
 
. : . : . : . : . : . :
rJMFF034I15+ CTACAAGGACCAGTGGCCCTGGAGTATAAAAATATATACAGATGAGCAAGGAAATAACAA
                      ____________________________________________________________
consensus CTACAAGGACCAGTGGCCCTGGAGTATAAAAATATATACAGATGAGCAAGGAAATAACAA
 
. : . : . : . : . : . :
rJMFF034I15+ AGGTGATGCGGTGCTGTCTTATGAAGATCCTTCTGCGGCCCACTCTGCTGGTGGCTTCTT
rJMFF025A07+ CTCTGNTGGTGGCTTCTT
                      ____________________________________________________________
consensus AGGTGATGCGGTGCTGTCTTATGAAGATCCTTCTGCGGCCCACTCTGCTGGTGGCTTCTT
 
. : . : . : . : . : . :
rJMFF034I15+ CAATAATCACATGTTGAGAGGTAACAAAATCAGTGTTGTGATGGCTGAGAAGTCTGCCCC
rJMFF025A07+ CAATAATCACATGTNGAGAGGTAACAAAATCAGTGTTGTGATGGCTGAGAAGTCTGCCCC
rJMFF047B14+ GAGGTAACAAAATCAGTGTTGTGATGGCTGAGAAGTCTGCCCC
                      ____________________________________________________________
consensus CAATAATCACATGTTGAGAGGTAACAAAATCAGTGTTGTGATGGCTGAGAAGTCTGCCCC
 
. : . : . : . : . : . :
rJMFF034I15+ AAAAGCTGCTCCTGCATATGGTTCCAGGGGTGGTGGCAGAGGTGGTTACGGTGGTGGTGG
rJMFF025A07+ AAAAGCTGCTCCTGCATANGGTTCCAGGGGTGGTGGCAGAGGTGGTTACGGTGGTGGTGG
rJMFF047B14+ AAAAGCTGCTCCTGCATATGGTTCCAGGGGTGGTGGCAGAGGTGGTTACGGTGGTGGTGG
                      ____________________________________________________________
consensus AAAAGCTGCTCCTGCATATGGTTCCAGGGGTGGTGGCAGAGGTGGTTACGGTGGTGGTGG
 
. : . : . : . : . : . :
rJMFF034I15+ TGATAGACGGAGAGACAACTACAGAGATGGAGGCTCTGGTCCAGATAGGAACTACCACGG
rJMFF025A07+ TGATAGACGGAGAGACAACTACAGAGATGGAGGCTCTGGTCCAGATAGGAACTACCACGG
rJMFF047B14+ TGATAGACGGAGAGACAACTACAGAGATGGAGGCTCTGGTCCAGATAGGAACTACCACGG
                      ____________________________________________________________
consensus TGATAGACGGAGAGACAACTACAGAGATGGAGGCTCTGGTCCAGATAGGAACTACCACGG
 
. : . : . : . : . : . :
rJMFF034I15+ TGGAAACCGATCACGACCATATTGAGTTTCAGCCAAGAATCTTATGTACTAAATTTGTGA
rJMFF025A07+ TGGAAACCGATCACGACCATATTGAGTTTCAGCCAAGAATCTTATGTACTAAATTTGTGA
rJMFF047B14+ TGGAAACCGATCACGACCATATTGAGTTTCAGCCAAGAATCTTATGTACTAAATTTGTGA
                      ____________________________________________________________
consensus TGGAAACCGATCACGACCATATTGAGTTTCAGCCAAGAATCTTATGTACTAAATTTGTGA
 
. : . : . : . : . : . :
rJMFF034I15+ TGGGAGGGTTTTTCTTTAATTCAATTCCCAGATATATTCTCTTAATTGGTGACTAAGAGG
rJMFF025A07+ TGGGAGGGTTTTTCTTTAATTCAATTCCCAGATATATTCTNTTAATTGGTGACTAAGAGG
rJMFF047B14+ TGGGAGGGTTTTTCTTTAATTCAATTCCCAGATATATTCTCTTAATTGGTGACTAAGAGG
                      ____________________________________________________________
consensus TGGGAGGGTTTTTCTTTAATTCAATTCCCAGATATATTCTCTTAATTGGTGACTAAGAGG
 
. : . : . : . : . : . :
rJMFF034I15+ TAGGTTGTCCTCATAACTCTGAGCAATACCCTTCTTTTGGTAATTGCTACATGGTGGGAG
rJMFF025A07+ TAGGTTGTCCTCATAACTCTGAGCAATACCCTTCTTTTGGTAATTGCTACATGGTGGGAG
rJMFF047B14+ TAGGTTGTCCTCATAACTCTGAGCAATACCCTTCTTTTGGTAATTGCTACATGGTGGGAG
                      ____________________________________________________________
consensus TAGGTTGTCCTCATAACTCTGAGCAATACCCTTCTTTTGGTAATTGCTACATGGTGGGAG
 
. : . : . : . : . : . :
rJMFF034I15+ CGTTTTCCAGTTGGAAGTTTGATTAATATGAACTATGTGAATGTTTTTGATAGACGGCGA
rJMFF025A07+ CGTTTTCCAGTTGGAAGTTTGATTAATATGAACTATGNGAATGTTTTTGATAGACGGCGA
rJMFF047B14+ CGTTTTCCAGTTGGAAGTTTGATTAATATGAACTATGTGAATGTTTTTGATAGACGGCGA
                      ____________________________________________________________
consensus CGTTTTCCAGTTGGAAGTTTGATTAATATGAACTATGTGAATGTTTTTGATAGACGGCGA
 
. : . : . : . : . : . :
rJMFF034I15+ ATGGA
rJMFF025A07+ ATGGATATTCCTCAAATTGCTGCTAAGCTAAGGTAGGTTGAAATATTCAGGTGAGTGTTG
rJMFF047B14+ ATGGATATTCCTCAAATTGCTGCTAAGCTAAGGTAGGTTGAAATATTCAGGTGAGTGTTG
                      ____________________________________________________________
consensus ATGGATATTCCTCAAATTGCTGCTAAGCTAAGGTAGGTTGAAATATTCAGGTGAGTGTTG
 
. : . : . : . : . : . :
rJMFF025A07+ CTTCTTTGAACATCCCATACT
rJMFF047B14+ CTTCTTTGAACATCCCATACTTGGAGACTAAATTTAAGGATGTTTTGTTTGCATTTTAAC
                      ____________________________________________________________
consensus CTTCTTTGAACATCCCATACTTGGAGACTAAATTTAAGGATGTTTTGTTTGCATTTTAAC