Previous Contig 010700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047B03Sequence645002005 (3)gb:AP004855_18460361e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15260010700 (3)pir|E86334|E863341e-08hypothetical protein T20H2.13 [imported] - Arabidopsis thaliana>gb:AE005172_8909
JMSF005K01Sequence396002005 (3)gb:AP004855_18460364e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15479010700 (3)gb:AY835402_16303403e-51Brassica napus clone BnY2H109 protein kinase C conserved region 2 mRNA, partial
JMSF011D03Sequence296002005 (3)gb:AP004855_18460360.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15731010700 (3)gb:AP006149_18609464e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B127

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011D03+ ATCTCAAGTACTGGAGATCTATGTT
                      ____________________________________________________________
consensus ATCTCAAGTACTGGAGATCTATGTT
 
. : . : . : . : . : . :
rJMSF011D03+ TATGATTGGGAGCAGGTTGGGAAACATGAAAAGATGGGCATGAATGTTATCCCACTCAAG
                      ____________________________________________________________
consensus TATGATTGGGAGCAGGTTGGGAAACATGAAAAGATGGGCATGAATGTTATCCCACTCAAG
 
. : . : . : . : . : . :
rJMSF011D03+ GATCTAACCCCTGATGATCCAAAAACTATGACCCTTGATCTCCTAAAGAATATGGATCCA
                      ____________________________________________________________
consensus GATCTAACCCCTGATGATCCAAAAACTATGACCCTTGATCTCCTAAAGAATATGGATCCA
 
. : . : . : . : . : . :
rJMSF005K01+ GCCA
rJMSF011D03+ AATGATATTCAGAACAATAAATCACGTGGGCAGATCATGATGGAACTAACTTACAAGCCA
                      ____________________________________________________________
consensus AATGATATTCAGAACAATAAATCACGTGGGCAGATCATGATGGAACTAACTTACAAGCCA
 
. : . : . : . : . : . :
rJMSF005K01+ NTCAAGGAGGAGGACAAGCCAAACCAATGTTGAGTCTGGTACANTTGAAAAAGCTCCAGA
rJMSF011D03+ TTCAAGGAGGAGGACAAGCCAAA-CAATGTTGAGTCTGGTACAATTGAAAAAGCTCCAGA
                      ____________________________________________________________
consensus TTCAAGGAGGAGGACAAGCCAAACCAATGTTGAGTCTGGTACAATTGAAAAAGCTCCAGA
 
. : . : . : . : . : . :
rJMSF005K01+ AGGGACACCGCCAGGAGGAGGTGTACTTGCAGTATTAATCCATGAAGCTGAAGATGTTGA
rJMSF011D03+ AGGGACACCGCCAGGAGGAGGTGTACTTGCAGTATTAATCCATGAAGCTGAAGATGTTGA
                      ____________________________________________________________
consensus AGGGACACCGCCAGGAGGAGGTGTACTTGCAGTATTAATCCATGAAGCTGAAGATGTTGA
 
. : . : . : . : . : . :
rJMSF005K01+ AGGAAAGCACCATACTAACCCATATGTCCGTATCATTTTTAAAGGGGAGGAGAAAAAAAC
rJMSF011D03+ AGGAAAGCACCATACTAACCCATATGTCCGTATCATTTTTAAAGGGGAGGAGAAAAAAAC
                      ____________________________________________________________
consensus AGGAAAGCACCATACTAACCCATATGTCCGTATCATTTTTAAAGGGGAGGAGAAAAAAAC
 
. : . : . : . : . : . :
rJMSF005K01+ TAAGCAACTGAAGAAAAGTAGGGATCCAAGATGGGATGAGGAGTTCACTTTCATGTTGGA
rJMSF011D03+ TAAGCAACTGAAGAAAAGTAGGGATCCAAGATGGGATGAGGAGTTCACTTTCATGTTGGA
                      ____________________________________________________________
consensus TAAGCAACTGAAGAAAAGTAGGGATCCAAGATGGGATGAGGAGTTCACTTTCATGTTGGA
 
. : . : . : . : . : . :
rJMSF005K01+ GAAGCCTCCTGTGGATGATAAGCTGCACATAGAAGTNGTCAGCACCTCAATGAGGATCGG
rJMSF011D03+ GAAGCCTCCTGTGGATGATAAGCTGCACATAGAAGTTGTCAGCACCTCAATGAGGATCGG
                      ____________________________________________________________
consensus GAAGCCTCCTGTGGATGATAAGCTGCACATAGAAGTTGTCAGCACCTCAATGAGGATCGG
 
. : . : . : . : . : . :
rJMSF005K01+ TTTACTGCATCCTAAGGAAATACTGGGGTATGTTGATATCAACCTTTCAGATGTTGTTAG
rJMSF011D03+ TTTACTGCATCCTAAGGAAATACTGGGGTATGTTGATATCAACCTTTCAGGTGTTGTTAG
rJMFF047B03+ ATCAACCTTTCAGATGTTGTTAG
                      ____________________________________________________________
consensus TTTACTGCATCCTAAGGAAATACTGGGGTATGTTGATATCAACCTTTCAGATGTTGTTAG
 
. : . : . : . : . : . :
rJMSF005K01+ CAACAAAAGGATCAACGAGAAGTACCATCTCATTGATTCAAAGAATGGGAAGATTCAAAT
rJMSF011D03+ CAACAAAAGGATCAACGAGAAGTACCATCTCATTGATTCAAAGAATGGGAAGATTCAAAT
rJMFF047B03+ CAACAAAAGGATCAACGAGAAGTTCCATCTCATTGATTCAAAGAATGGGAAGATTCAAAT
                      ____________________________________________________________
consensus CAACAAAAGGATCAACGAGAAGTACCATCTCATTGATTCAAAGAATGGGAAGATTCAAAT
 
. : . : . : . : . : . :
rJMSF005K01+ TGAGCTGACATGGAATTCGGCTTCTTAATCTTGGTTGGNGTTAGTGAGAC
rJMSF011D03+ TGAGCTGACATGGAATTCGGCTTCTTAATCTTGGTTGGTGTTATTGAGACCAAGAATTGT
rJMFF047B03+ TGAGCTGACATGGAATTCGGCTTTTTAATCTTGGTTGGTGTTATTGAGA-CAAGAATTGT
                      ____________________________________________________________
consensus TGAGCTGACATGGAATTCGGCTTCTTAATCTTGGTTGGTGTTATTGAGACCAAGAATTGT
 
. : . : . : . : . : . :
rJMSF011D03+ ACTGTATATGTACCTTGATGTACATTATTACCCATTTACTTT
rJMFF047B03+ ACTGTATATGTA-CTTGATGTACATTATTA-CCATTTACTTTTACAAATTCTCGGTGATA
                      ____________________________________________________________
consensus ACTGTATATGTACCTTGATGTACATTATTACCCATTTACTTTTACAAATTCTCGGTGATA
 
. : . : . : . : . : . :
rJMFF047B03+ TGTTTTGCTCTTTTGCTTCGGCTTTATCATATTTTACTCATGGCAGAGAATTTTTTCCTG
                      ____________________________________________________________
consensus TGTTTTGCTCTTTTGCTTCGGCTTTATCATATTTTACTCATGGCAGAGAATTTTTTCCTG