Previous Contig 010690:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026N04Sequence480001266 (16)gb:AC145396_17444521e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet738010690 (9)sp|Q9XIK4|U202_ARATH5e-19Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMFF032J19Sequence237001266 (16)650010690 (9)sp|Q9XIK4|U202_ARATH4e-07Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMFF046P22Sequence437001266 (16)gb:AC145396_17444522e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet458010690 (9)
JMSF010M14Sequence304005181 (3)sp|Q9M2Q4|U203_ARATH4e-18Hypothetical UPF0202 protein At3g57940.>pir|T46016|T46016 hypothetical protein T760010690 (9)sp|Q9XIK4|U202_ARATH5e-19Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMSF019M11Sequence485006311 (4)sp|Q9M2Q4|U203_ARATH5e-26Hypothetical UPF0202 protein At3g57940.>pir|T46016|T46016 hypothetical protein T742010690 (9)sp|Q9XIK4|U202_ARATH1e-23Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMSF025J20Sequence139006311 (4)783010690 (9)sp|Q9XIK4|U202_ARATH3e-63Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMSF037F15Sequence662005181 (3)sp|Q9M2Q4|U203_ARATH4e-53Hypothetical UPF0202 protein At3g57940.>pir|T46016|T46016 hypothetical protein T738010690 (9)sp|Q9XIK4|U202_ARATH6e-25Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMSF039J09Sequence671006311 (4)sp|Q9M2Q4|U203_ARATH3e-54Hypothetical UPF0202 protein At3g57940.>pir|T46016|T46016 hypothetical protein T870010690 (9)sp|Q9XIK4|U202_ARATH4e-36Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMSF047H05Sequence706006311 (4)sp|Q9M2Q4|U203_ARATH9e-55Hypothetical UPF0202 protein At3g57940.>pir|T46016|T46016 hypothetical protein T774010690 (9)sp|Q9XIK4|U202_ARATH1e-19Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025J20+ TGGAGTAAACATAAATTGGC
                      ____________________________________________________________
consensus TGGAGTAAACATAAATTGGC
 
. : . : . : . : . : . :
rJMSF025J20+ CCATTCTTCATTGGCCATAGCCCAAATAGTGTGACTGGGGAGCACACATGCATGGTCTTG
                      ____________________________________________________________
consensus CCATTCTTCATTGGCCATAGCCCAAATAGTGTGACTGGGGAGCACACATGCATGGTCTTG
 
. : . : . : . : . : . :
rJMSF025J20+ AAGCCCTTGAACAGTGATGATATTGAAGTTAATGGATCCAATGAGTGGGGGTTTTTTGGT
                      ____________________________________________________________
consensus AAGCCCTTGAACAGTGATGATATTGAAGTTAATGGATCCAATGAGTGGGGGTTTTTTGGT
 
. : . : . : . : . : . :
rJMSF025J20+ CCTTTTTACCAAGATTTTCGGAAGAGATTTGCAAGGCTACTGGATAAAAGCTTCCGTTCT
                      ____________________________________________________________
consensus CCTTTTTACCAAGATTTTCGGAAGAGATTTGCAAGGCTACTGGATAAAAGCTTCCGTTCT
 
. : . : . : . : . : . :
rJMSF025J20+ ATGGAGTACAAGCTTGCTATGAGTGTATTGGATCCGAAGATCGATTTCGCAGAGGTTGAC
                      ____________________________________________________________
consensus ATGGAGTACAAGCTTGCTATGAGTGTATTGGATCCGAAGATCGATTTCGCAGAGGTTGAC
 
. : . : . : . : . : . :
rJMSF025J20+ TCATCGGATGGATTTTTGGAATCCATTGATGGAATATTTTCTCCACATGATATGAAGAGG
                      ____________________________________________________________
consensus TCATCGGATGGATTTTTGGAATCCATTGATGGAATATTTTCTCCACATGATATGAAGAGG
 
. : . : . : . : . : . :
rJMSF025J20+ CTTGAAGCCTACACAAACAATCTTGTGGATTTTCAGTCGATTATGGATTGTGTCTCAATA
rJMSF039J09+ ATGGATTGTGTCTCAATA
                      ____________________________________________________________
consensus CTTGAAGCCTACACAAACAATCTTGTGGATTTTCAGTCGATTATGGATTGTGTCTCAATA
 
. : . : . : . : . : . :
rJMSF025J20+ CTTGCACACTTGTATTTCTCAGAGAAGCTCCCAGTTTCACTTTCATATACTCAGGCTTCT
rJMSF039J09+ CTTGCACACTTGTATTTCTCAGAGAAGCTCCCAGTTTCACTTTCATATACTCAGGCTTCT
                      ____________________________________________________________
consensus CTTGCACACTTGTATTTCTCAGAGAAGCTCCCAGTTTCACTTTCATATACTCAGGCTTCT
 
. : . : . : . : . : . :
rJMSF025J20+ GTTCTGCTTTGCATTGGTTTGCAGGATAAAGATATTTCTCAGATTGAGGGAGAAACGCGT
rJMSF019M11+ TTGGTTTGCAGGATAAAGATATTTCTCAGATTGAGGGAGAAACGCGT
rJMSF037F15+ TTGGTTTGCAGGATAAAGATATTTCTCAGATTGAGGGAGAAACGCGT
rJMSF039J09+ GTTCTGCTTTGCATTGGTTTGCAGGATAAAGATATTTCTCAGATTGAGGGAGAAACGCGT
rJMSF047H05+ CGT
                      ____________________________________________________________
consensus GTTCTGCTTTGCATTGGTTTGCAGGATAAAGATATTTCTCAGATTGAGGGAGAAACGCGT
 
. : . : . : . : . : . :
rJMSF025J20+ CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMSF019M11+ CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMSF037F15+ CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMSF039J09+ CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMSF010M14+ GAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMFF026N04+ GAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
rJMSF047H05+ CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
                      ____________________________________________________________
consensus CTGGAAAGACAGCAGATTTTGTCTTTATTTATAAAGACAATGAAGAAGTTCTACAAGTAC
 
. : . : . : . : . : . :
rJMSF025J20+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAA
rJMSF019M11+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
rJMSF037F15+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
rJMSF039J09+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
rJMFF032J19+ CTAGAAGAAATAAAG
rJMSF010M14+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
rJMFF026N04+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
rJMSF047H05+ TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
                      ____________________________________________________________
consensus TTGTATGGCCTTGCCTCCAAAGAGATTGATTCAATTGTATCTCGACTAGAAGAAATAAAG
 
. : . : . : . : . : . :
rJMSF019M11+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMSF037F15+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMSF039J09+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMFF032J19+ ATGGAGCNTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMSF010M14+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMFF026N04+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
rJMSF047H05+ ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
                      ____________________________________________________________
consensus ATGGAGCCTCTTGCTATATCATTGGACGATGATCTTAACAATGCGGCAAAACAAGTCCAG
 
. : . : . : . : . : . :
rJMSF019M11+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMSF037F15+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMSF039J09+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMFF032J19+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMSF010M14+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMFF026N04+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
rJMSF047H05+ GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
                      ____________________________________________________________
consensus GAGGAGATGAATGCCAAAATGGATGGTCTATTAGACCCAGATCTACTTCAAGGATATGCC
 
. : . : . : . : . : . :
rJMSF019M11+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMSF037F15+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMSF039J09+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMFF032J19+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMSF010M14+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMFF026N04+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
rJMSF047H05+ ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
                      ____________________________________________________________
consensus ATCGTGGATAGAGAAGCTGATTTTGAGAATGCCCTGCAAAATGGAGGAGGAAAGGTACTT
 
. : . : . : . : . : . :
rJMSF019M11+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMSF037F15+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMSF039J09+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMFF032J19+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMSF010M14+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMFF026N04+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMSF047H05+ CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
rJMFF046P22+ GAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
                      ____________________________________________________________
consensus CCCGGTGGAGTAATCAGCGTGAAATCCAACAACAGAATCAAGGTTGATAAAGGCCAGAAG
 
. : . : . : . : . : . :
rJMSF019M11+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMSF037F15+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMSF039J09+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMFF032J19+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMSF010M14+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMFF026N04+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMSF047H05+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
rJMFF046P22+ GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
                      ____________________________________________________________
consensus GGTGAGAAGAAGAGAAGCAAGAATTACCTATCCAAATCAAGCAAGAAAAGGAAGTCTTGA
 
. : . : . : . : . : . :
rJMSF019M11+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMSF037F15+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMSF039J09+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMFF032J19+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMSF010M14+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMFF026N04+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMSF047H05+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
rJMFF046P22+ CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
                      ____________________________________________________________
consensus CCTGTTGAAGGTACGGCCTTGTCATATTTTCTAATGTATAGATCGAGCTTTTGTTCTCTT
 
. : . : . : . : . : . :
rJMSF019M11+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMSF037F15+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMSF039J09+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMFF032J19+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMSF010M14+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMFF026N04+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMSF047H05+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
rJMFF046P22+ GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
                      ____________________________________________________________
consensus GATTGTGAGCGGTCAGCTAGTTGAACAATTTCAATATATATATTTGATGGAAATGTGACA
 
. : . : . : . : . : . :
rJMSF019M11+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMSF037F15+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMSF039J09+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMFF032J19+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMSF010M14+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMFF026N04+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMSF047H05+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
rJMFF046P22+ ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
                      ____________________________________________________________
consensus ACAACCCAACCAACCTTATCATGAGTTGGGTAATCAATTTTGAGTATTGTGACAAAGCAT
 
. : . : . : . : . : . :
rJMSF019M11+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGAC
rJMSF037F15+ TTTGAAGCATAAACCCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMSF039J09+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMFF032J19+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMSF010M14+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMFF026N04+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMSF047H05+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
rJMFF046P22+ TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
                      ____________________________________________________________
consensus TTTGAAGCATAAA-CCTTGTGCCCTTAGTAGATTATTCCCATTAGGGTTTAGATTAGGA-
 
. : . : . : . : . : . :
rJMSF019M11+ CAAGGTTTTACATAATGATTATCATGTTGTAACT
rJMSF037F15+ CAAGGTTTTACATAATGATTATCATGT
rJMSF039J09+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
rJMFF032J19+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
rJMSF010M14+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
rJMFF026N04+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
rJMSF047H05+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
rJMFF046P22+ CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
                      ____________________________________________________________
consensus CAAGGTTTTACATAATGATTATCATGTTGTAACTTGTAAGGTTAAAATGTTAGATGCTTT
 
. : . : . : . : . : . :
rJMSF039J09+ CTCCTTCTGATGTT
rJMFF032J19+ CTCCTTCTGATGTTTGCTTCTCGTGGATAATCTTTAT
rJMSF010M14+ CTCCTTCTGATGTTTACTTCTCGTGGATAATCTTTAT
rJMFF026N04+ CTCCTTCTGATGTTTGCTTCTCG
rJMSF047H05+ CTCCTTCTGATGTTTACTTCTCGTGGATAATCTTTAT
rJMFF046P22+ CTCCTTCTGATGTTTGCTTCTCGTGGATAATCTTTATTAGAAACGTTGAGTTTGGTTCGG
                      ____________________________________________________________
consensus CTCCTTCTGATGTTTGCTTCTCGTGGATAATCTTTATTAGAAACGTTGAGTTTGGTTCGG