Previous Contig 010687:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043J03Sequence646005581 (7)gb:AF326729_17866992e-31Nicotiana tabacum TMV-MP30 binding protein 2C mRNA, complete cds.598010687 (2)gb:AF326729_17866995e-31Nicotiana tabacum TMV-MP30 binding protein 2C mRNA, complete cds.
JMFF046P05Sequence547005581 (7)gb:AX250473_14648347e-28Sequence 79 from Patent WO0168863.417010687 (2)gb:AF326729_17866990.005Nicotiana tabacum TMV-MP30 binding protein 2C mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043J03+ ACGA
                      ____________________________________________________________
consensus ACGA
 
. : . : . : . : . : . :
rJMFF043J03+ GATAGCTTCCCTTCATTCCAAACTTGATGAAATGCAAAAGGAATTTGCTGAAAAGGACTC
                      ____________________________________________________________
consensus GATAGCTTCCCTTCATTCCAAACTTGATGAAATGCAAAAGGAATTTGCTGAAAAGGACTC
 
. : . : . : . : . : . :
rJMFF043J03+ TTTACTCAGATCTACTCAAATGCAGCTCTCCGATGCAAAGATAAAGCTAGCTGATAAGCA
                      ____________________________________________________________
consensus TTTACTCAGATCTACTCAAATGCAGCTCTCCGATGCAAAGATAAAGCTAGCTGATAAGCA
 
. : . : . : . : . : . :
rJMFF043J03+ AGCTGCCGTGGAGAAATTAGAATGGGAGGCAACAACTTCCACCAAGAAGGTGGGGAAGCT
                      ____________________________________________________________
consensus AGCTGCCGTGGAGAAATTAGAATGGGAGGCAACAACTTCCACCAAGAAGGTGGGGAAGCT
 
. : . : . : . : . : . :
rJMFF043J03+ CCAGGAAGATCTAGAAGCAATGCAGGGAGAGTTTTCATTATTTATGAAGTTCCTAGGAGA
                      ____________________________________________________________
consensus CCAGGAAGATCTAGAAGCAATGCAGGGAGAGTTTTCATTATTTATGAAGTTCCTAGGAGA
 
. : . : . : . : . : . :
rJMFF043J03+ GTTGACAAAGACTAATGTGACCCAGCCTGACGAAGAGTATTATGAAGATTACGACGCTTC
                      ____________________________________________________________
consensus GTTGACAAAGACTAATGTGACCCAGCCTGACGAAGAGTATTATGAAGATTACGACGCTTC
 
. : . : . : . : . : . :
rJMFF043J03+ TTATCCCTGGGATGACCCGGGCACTGAGGATGATCTCGACAAGATGCAAAGCTTGGAGGC
rJMFF046P05+ TCCCTGGGATGACCCGGGCACTGAGGATGATCTCGACAAGATGCAAAGCTTGGAGGC
                      ____________________________________________________________
consensus TTATCCCTGGGATGACCCGGGCACTGAGGATGATCTCGACAAGATGCAAAGCTTGGAGGC
 
. : . : . : . : . : . :
rJMFF043J03+ AGCAAGGGAAGCTTACGTTGCTGCCTTGGCTACTGCTAAAGAAAGACAAGATGAATCATC
rJMFF046P05+ AGCAAGGGAAGCTTACGTTGCTGCCTTGGCTACTGCTAAAGAAAGACAAGATGAATCATC
                      ____________________________________________________________
consensus AGCAAGGGAAGCTTACGTTGCTGCCTTGGCTACTGCTAAAGAAAGACAAGATGAATCATC
 
. : . : . : . : . : . :
rJMFF043J03+ CATTTCTGCAGCTGCCACTGCAAGAAAACATTTGGAATCACTAGTTCGTCTGCTCTGATA
rJMFF046P05+ CATTTCTGCAGCTGCCACTGCAAGAAAACATTTGGAATCACTAGTTCGTCTGCTCTGATA
                      ____________________________________________________________
consensus CATTTCTGCAGCTGCCACTGCAAGAAAACATTTGGAATCACTAGTTCGTCTGCTCTGATA
 
. : . : . : . : . : . :
rJMFF043J03+ AAACGAGAACGAAGCAACTTACTGTAACTCCATTCCACATATTGTGTGTTAAATCAGTTC
rJMFF046P05+ AAACGAGAACGAAGCAACTTACTGTAACTCCATTCCACATATTGTGTGTTAAATCAGTTC
                      ____________________________________________________________
consensus AAACGAGAACGAAGCAACTTACTGTAACTCCATTCCACATATTGTGTGTTAAATCAGTTC
 
. : . : . : . : . : . :
rJMFF043J03+ TAGAGACAAGGGTTTTCTTAGATATTTAGTTGCTTATCCCATGTAGGTTTGAAC
rJMFF046P05+ TAGAGACAAGGGTTTTTTTAGATATTTAGTTGCTTATCCCAAGTAGGTTTGAACAAAAAA
                      ____________________________________________________________
consensus TAGAGACAAGGGTTTTTTTAGATATTTAGTTGCTTATCCCATGTAGGTTTGAACAAAAAA
 
. : . : . : . : . : . :
rJMFF046P05+ AAAAAAAATAATAATATTGTCTGTTTTGTTTTGGATGATGAAATCTTTGAAATGTAACAA
                      ____________________________________________________________
consensus AAAAAAAATAATAATATTGTCTGTTTTGTTTTGGATGATGAAATCTTTGAAATGTAACAA
 
. : . : . : . : . : . :
rJMFF046P05+ TGGTGACCTGCACTTTGTATTATAACACTCATTTCCTATTAATGCTATATGCCTTACACG
                      ____________________________________________________________
consensus TGGTGACCTGCACTTTGTATTATAACACTCATTTCCTATTAATGCTATATGCCTTACACG