Previous Contig 010683:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046O14Sequence539010683 (10)gb:AY804011_16286304e-38Lycopersicon esculentum phosphate transporter 3 (PT3) gene, partial cds.494010683 (10)gb:AF156696_17730342e-19Nicotiana tabacum inorganic phosphate transporter (PT1) mRNA, complete cds.
JMSF006L16Sequence341010683 (10)gb:SRO286743_17224193e-44Sesbania rostrata mRNA for phosphate transporter (pt1 gene).338010683 (10)pir|T07808|T078086e-09probable inorganic phosphate transport protein - Madagascar periwinkle>gb:AB0048
JMSF019B13Sequence495010683 (10)gb:AY804011_16286303e-50Lycopersicon esculentum phosphate transporter 3 (PT3) gene, partial cds.791010683 (10)gb:AF156696_1773034e-102Nicotiana tabacum inorganic phosphate transporter (PT1) mRNA, complete cds.
JMSF045K18Sequence750010683 (10)gb:SRO286743_1722419e-103Sesbania rostrata mRNA for phosphate transporter (pt1 gene).791010683 (10)gb:AF156696_17730347e-76Nicotiana tabacum inorganic phosphate transporter (PT1) mRNA, complete cds.
JMSF051N01Sequence642010683 (10)gb:SRO286744_17224205e-85Sesbania rostrata mRNA for phosphate transporter (pt2 gene).705010683 (10)gb:AF156696_17730341e-77Nicotiana tabacum inorganic phosphate transporter (PT1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046O14- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFF046O14- AGTTCTCGAGAAAGAAGCAAGAGATTGCGACAGAGTTGACCCGGTTAACGGGTATATACT
                      ____________________________________________________________
consensus AGTTCTCGAGAAAGAAGCAAGAGATTGCGACAGAGTTGACCCGGTTAACGGGTATATACT
 
. : . : . : . : . : . :
JMFF046O14- GCAAGGCAATAATATGCCCCACTAAACTATTCTTTGTGAATTGTGAAGCCCTTTCTACAC
JMSF019B13- ACAC
                      ____________________________________________________________
consensus GCAAGGCAATAATATGCCCCACTAAACTATTCTTTGTGAATTGTGAAGCCCTTTCTACAC
 
. : . : . : . : . : . :
JMFF046O14- GCCTTAAATATCACAATCCACTCTCCCTCCATCTTCAACCTGCATACTTATCACTTCTGC
JMSF019B13- GCCTTAAATATCACAATCCACTCTCCCTCCATCTTCAACCTGCATACTTATCACTTCTGC
JMSF051N01- AACCTGCATACTTATCACTTCTGC
                      ____________________________________________________________
consensus GCCTTAAATATCACAATCCACTCTCCCTCCATCTTCAACCTGCATACTTATCACTTCTGC
 
. : . : . : . : . : . :
JMFF046O14- AGATCAGACTGTGCTTCTGCTCTACATGTCTTAAGTAGAACAAGCAGAGTGTAATTAGAA
JMSF019B13- AGATCAGACTGTGCTTCTGCTCTACATGTCTTAAGTAGAACAAGCAGAGTGTAATTAGAA
JMSF051N01- AGATCAGACTGTGCTTCTGCTCTACATGTCTTAAGTAGAACAAGCAGAGTGTAATTAGAA
                      ____________________________________________________________
consensus AGATCAGACTGTGCTTCTGCTCTACATGTCTTAAGTAGAACAAGCAGAGTGTAATTAGAA
 
. : . : . : . : . : . :
JMFF046O14- GAAAGAGCAGGGAAGAAGAAGATGGCTAGAGAACAGCTGCAAGTGCTAAATGCACTAGAT
JMSF019B13- GAAAGAGCAGGGAAGAAGAAGATGGCTAGAGAACAGCTGCAAGTGCTAAATGCACTAGAT
JMSF051N01- GAAAGAGCAGGGAAGAAGAAGATGGCTAGAGAACAGCTGCAAGTGCTAAATGCACTAGAT
                      ____________________________________________________________
consensus GAAAGAGCAGGGAAGAAGAAGATGGCTAGAGAACAGCTGCAAGTGCTAAATGCACTAGAT
 
. : . : . : . : . : . :
JMFF046O14- GTCGCCAAGACTCAACTTTACCATTTCACGGCCATCATTATCGCCGGAATGGGGTTTTTC
JMSF019B13- GTCGCCAAGACTCAACTTTACCATTTCACGGCCATCATTATCGCCGGAATGGGGTTTTTC
JMSF051N01- GTCGCCAAGACTCAACTTTACCATTTCACGGCCATCATTATCGCCGGAATGGGGTTTTTC
                      ____________________________________________________________
consensus GTCGCCAAGACTCAACTTTACCATTTCACGGCCATCATTATCGCCGGAATGGGGTTTTTC
 
. : . : . : . : . : . :
JMFF046O14- ACCGACGCCTACGATCTTTTCAGCATTTCCCTTGTCACCAAGCTTCTAGGCCGCATTTAC
JMSF019B13- ACCGACGCCTACGATCTTTTCAGCATTTCCCTTGTCACCAAGCTTCTAGGCCGCATTTAC
JMSF051N01- ACCGACGCCTACGATCTTTTCAGCATTTCCCTTGTCACCAAGCTTCTAGGCCGCATTTAC
                      ____________________________________________________________
consensus ACCGACGCCTACGATCTTTTCAGCATTTCCCTTGTCACCAAGCTTCTAGGCCGCATTTAC
 
. : . : . : . : . : . :
JMFF046O14- TACACTAACCTCAACAAAGAAAAGCCCGGCACCCTCCCTCCGGGAATCTCCGCCGCCGTC
JMSF019B13- TACACTAACCTCAACAAAGAAAAGCCCGGCACCCTCCCTCCGGGAATCTCCGCCGCCGTC
JMSF051N01- TACACTAACCTCAACAAAGAAAAGCCCGGCACCCTCCCTCCGGGAATCTCCGCCGCCGTC
                      ____________________________________________________________
consensus TACACTAACCTCAACAAAGAAAAGCCCGGCACCCTCCCTCCGGGAATCTCCGCCGCCGTC
 
. : . : . : . : . : . :
JMFF046O14- ACCGGCGTCGCCCTCGTCGGAACCCTCGCCGGTCAGCTCTTTTTCGGCTGGCTCGGCG
JMSF019B13- ACCGGCGTCGCCCTCGTCGGAACCCTCGCCGGTCAGCTCTTTTTCGGCTGGCTCGGCGAC
JMSF051N01- ACCGGCGTCTCCCTCGTCGGAACCCTCGCCGGTCAGCTCTTTTTCGGCTGGCTCGGCGAC
                      ____________________________________________________________
consensus ACCGGCGTCGCCCTCGTCGGAACCCTCGCCGGTCAGCTCTTTTTCGGCTGGCTCGGCGAC
 
. : . : . : . : . : . :
JMSF019B13- AAAATGGGCCGGAAAAAGGTGTACGGTGTCACCCTCATCCTCATGATTGTTTGCTCTCTT
JMSF051N01- AAAATGGGCCGGAAAAAGGTGTACGGTGTCACCCTCATCCTCATGATTGTTTGCTCTCTT
JMSF006L16- AAGGTGTACGGTGTCACCCTCATCCTCATGATTGTTTGCTCTCTT
JMSF045K18- AAGGTGTACGGTGTCACCCTCATCCTCATGATTGTTTGCTCTCTT
                      ____________________________________________________________
consensus AAAATGGGCCGGAAAAAGGTGTACGGTGTCACCCTCATCCTCATGATTGTTTGCTCTCTT
 
. : . : . : . : . : . :
JMSF019B13- GCTTCCGGAC
JMSF051N01- GCTTCCGGACTTTCTTTTGGCAGCCACGCCAAAGGTGTCATGGCAACCCTTTGTTTCTTC
JMSF006L16- GCTTCCGGACTTTCTTTTGGCAGCCACGCCAAAGGTGTCATGGCAACCCTTTGTTTCTTC
JMSF045K18- GCTTCCGGACTTTCTTTTGGCAGCCACGCCAAAGGTGTCATGGCAACCCTTTGTTTCTTC
                      ____________________________________________________________
consensus GCTTCCGGACTTTCTTTTGGCAGCCACGCCAAAGGTGTCATGGCAACCCTTTGTTTCTTC
 
. : . : . : . : . : . :
JMSF051N01- AGATTTTGGCTGGGTTTTGGTATCGGCGGCGACTATCCACTCTCTGCCACAATCATGTCG
JMSF006L16- AGATTTTGGCTGGGTTTTGGTATCGGCGGCGACTATCCACTCTCTGCCACAATCATGTCG
JMSF045K18- AGATTTTGGCTGGGTTTTGGTATCGGCGGCGACTATCCACTCTCTGCCACAATCATGTCG
                      ____________________________________________________________
consensus AGATTTTGGCTGGGTTTTGGTATCGGCGGCGACTATCCACTCTCTGCCACAATCATGTCG
 
. : . : . : . : . : . :
JMSF051N01- GAATATGCTAACAAGAAGACAAGAGGAGCCTTTATAGCTGCGGTTTTCGCTATGCAAGGT
JMSF006L16- GAATATGCTAACAAGAAGACAAGAGGAGCCTTTATAGCTGCGGTTTTCGCTATGCAAGGT
JMSF045K18- GAATATGCTAACAAGAAGACAAGAGGAGCCTTTATAGCTGCGGTTTTCGCTATGCAAGGT
                      ____________________________________________________________
consensus GAATATGCTAACAAGAAGACAAGAGGAGCCTTTATAGCTGCGGTTTTCGCTATGCAAGGT
 
. : . : . : . : . : . :
JMSF051N01- TTTGGAATTCTGACTAG
JMSF006L16- TTTGGAATTCTGACTAGCGGGATTGTGGCACTGATTGTTTCCGCCGCTTTCGACCACGCT
JMSF045K18- TTTGGAATTCTGACTAGCGGGATTGTGGCACTGATTGTTTCCGCCGCTTTCGACCACGCT
                      ____________________________________________________________
consensus TTTGGAATTCTGACTAGCGGGATTGTGGCACTGATTGTTTCCGCCGCTTTCGACCACGCT
 
. : . : . : . : . : . :
JMSF006L16- TACGGCGCTCCGGCGTACGGAGCCAGCGTGGCGGCCCGCGCCGCCTCCACCGTGCC
JMSF045K18- TACGGCGCTCCGGCGTACGGAGCCAGCGTGGCGGCCCGCGCCGCCTCCACCGTGCCGCAG
                      ____________________________________________________________
consensus TACGGCGCTCCGGCGTACGGAGCCAGCGTGGCGGCCCGCGCCGCCTCCACCGTGCCGCAG
 
. : . : . : . : . : . :
JMSF045K18- GCCGACTACATTTGGCGCATAATTCTAATGTTCGGCGCGGTGCCGGCGGCGCTGACCTAC
                      ____________________________________________________________
consensus GCCGACTACATTTGGCGCATAATTCTAATGTTCGGCGCGGTGCCGGCGGCGCTGACCTAC
 
. : . : . : . : . : . :
JMSF045K18- TACTGGCGTATGAAGATGCCGGAAACCGCCCGTTACACCGCCCTGGTGGCGAAGAACGCC
                      ____________________________________________________________
consensus TACTGGCGTATGAAGATGCCGGAAACCGCCCGTTACACCGCCCTGGTGGCGAAGAACGCC
 
. : . : . : . : . : . :
JMSF045K18- AGACAGGCGGCGAAGGACATGGCGCAGGTCCTGAACGTGGAGCTGGAGGCGGAAGAAGAA
                      ____________________________________________________________
consensus AGACAGGCGGCGAAGGACATGGCGCAGGTCCTGAACGTGGAGCTGGAGGCGGAAGAAGAA
 
. : . : . : . : . : . :
JMSF045K18- AAGCTGGAGAAAATGGCGGAGAAGCCGGCGAATTCATTCGGGTTATTCTCTAAAGAATTC
rJMSF019B13+ AAGAATTC
                      ____________________________________________________________
consensus AAGCTGGAGAAAATGGCGGAGAAGCCGGCGAATTCATTCGGGTTATTCTCTAAAGAATTC
 
. : . : . : . : . : . :
JMSF045K18- GCTAAGCGTCACGGGCTCCATTTACTGGGAACCACCTCGACGTGGTTTCTGTTGGATATC
rJMSF019B13+ GNTAAGCGTCACGGGCTCCATTTACTGGGAACCACCTCGACGTGGTTTCTGTTGGATATC
                      ____________________________________________________________
consensus GCTAAGCGTCACGGGCTCCATTTACTGGGAACCACCTCGACGTGGTTTCTGTTGGATATC
 
. : . : . : . : . : . :
JMSF045K18- GCGTTTTACAGCAACAATTTGTTCCAGAAAGATATCTTCTCCGCCATTGGATGGATCCCG
rJMSF019B13+ GCGTTTTACAGCAACAATTTGTTCCAGAAAGATATCTTCTCCGCCATTGGATGGATCCCG
                      ____________________________________________________________
consensus GCGTTTTACAGCAACAATTTGTTCCAGAAAGATATCTTCTCCGCCATTGGATGGATCCCG
 
. : . : . : . : . : . :
JMSF045K18- GCGGCGAAGGAAATGAACG-CCGTGCACGAGGTTTATAGGGTGGCC
rJMSF019B13+ GCGGCGAAGGAAATGAACG-CCGTGCACGAGGTTTATAGGGTGGCCAAGGCGCAAACGTT
rJMSF051N01+ GGAAATGAACG-CCGTGCACGAGGTTTATAGGGTGGCCAAGGCGCAAACGTT
rJMSF045K18+ GGAAATGAACGCCCGTGCACGAGGTTTATAGGGTGGCCAAGGCGCAAACGTT
                      ____________________________________________________________
consensus GCGGCGAAGGAAATGAACG-CCGTGCACGAGGTTTATAGGGTGGCCAAGGCGCAAACGTT
 
. : . : . : . : . : . :
rJMSF019B13+ GATCGCGCTTTGCAGCACCGTGCCGGGGTACTGGTTCACCGTCGCCTTCATCGACGTGAT
rJMSF051N01+ GATCGCGCTTTGCAGCACCGTGCCGGGGTACTGGTTCACCGTCGCCTTCATCGACGTGAT
rJMSF045K18+ GATCGCGCTTTGCAGCACCGTGCCGGGGTACTGGTTCACCGTCGCCTTCATCGACGTGAT
                      ____________________________________________________________
consensus GATCGCGCTTTGCAGCACCGTGCCGGGGTACTGGTTCACCGTCGCCTTCATCGACGTGAT
 
. : . : . : . : . : . :
rJMSF019B13+ CGGGAGGTTTTGGATCCAATTGATGGGATTCTTCTTCATGACAGTTTTCATGTTCGCCCT
rJMSF051N01+ CGGGAGGTTTTGGATCCAATTGATGGGATTCTTCTTCATGACAGTTTTCATGTTCGCCCT
rJMSF045K18+ CGGGAGGTTTTGGATCCAATTGATGGGATTCTTCTTCATGACAGTTTTCATGTTCGCCCT
                      ____________________________________________________________
consensus CGGGAGGTTTTGGATCCAATTGATGGGATTCTTCTTCATGACAGTTTTCATGTTCGCCCT
 
. : . : . : . : . : . :
rJMSF019B13+ CGCGATCCCCTACGACCATTGGAGAGAAAAGCCGCACAGAATCGGGTTCGTCATCATGTA
rJMSF051N01+ CGCGATCCCCTACGACCATTGGAGAGAAAAGCCGCACAGAATCGGGTTCGTCATCATGTA
rJMSF045K18+ CGCGATCCCCTACGACCATTGGAGAGAAAAGCCGCACAGAATCGGGTTCGTCATCATGTA
                      ____________________________________________________________
consensus CGCGATCCCCTACGACCATTGGAGAGAAAAGCCGCACAGAATCGGGTTCGTCATCATGTA
 
. : . : . : . : . : . :
rJMSF019B13+ CTCCCTCACGTTCTTCTTCTCCAACTTCGGGCCTAACGCCACCACGTTCGTGGTCCCGGC
rJMSF051N01+ CTCCCTCACGTTCTTCTTCTCCAACTTCGGGCCTAACGCCACCACGTTCGTGGTCCCGGC
rJMSF045K18+ CTCCCTCACGTTCTTCTTCTCCAACTTCGGGCCTAACGCCACCACGTTCGTGGTCCCGGC
                      ____________________________________________________________
consensus CTCCCTCACGTTCTTCTTCTCCAACTTCGGGCCTAACGCCACCACGTTCGTGGTCCCGGC
 
. : . : . : . : . : . :
rJMSF019B13+ GGAGATTTTCCCGGCCAGGCTGCGGTCCACCTGCCACGGGATATCCGCGGCGGCCGGGAA
rJMSF051N01+ GGAGATTTTCCCGGCCAGGCTGCGGTCCACCTGCCACGGGATATCCGCGGCGGCCGGGAA
rJMSF045K18+ GGAGATTTTCCCGGCCAGGCTGCGGTCCACCTGCCACGGGATATCCGCGGCGGCCGGGAA
rJMFF046O14+ GCGGCGGCCGGGAA
                      ____________________________________________________________
consensus GGAGATTTTCCCGGCCAGGCTGCGGTCCACCTGCCACGGGATATCCGCGGCGGCCGGGAA
 
. : . : . : . : . : . :
rJMSF019B13+ GGCCGGCGCGATCGTCGGAGCGTTTGGGTTCTTGTATGCGTCGCAGCCCACGGACAAAAA
rJMSF051N01+ GGCCGGCGCGATCGTCGGAGCGTTTGGGTTCTTGTATGCGTCGCAGCCCACGGACAAAAA
rJMSF045K18+ GGCCGGCGCGATCGTCGGAGCGTTTGGGTTCTTGTATGCGTCGCAGCCCACGGACAAAAA
rJMFF046O14+ GGCCGGCGCGATCGTCGGAGCGTTTGGGTTCTNGTATGCGTCGCAGCCCACGGACAAAAA
                      ____________________________________________________________
consensus GGCCGGCGCGATCGTCGGAGCGTTTGGGTTCTTGTATGCGTCGCAGCCCACGGACAAAAA
 
. : . : . : . : . : . :
rJMSF019B13+ ACACGCGGACCCGGGGTACCCGGCTGGGATTGGGATAAAGAAAACGCTGATTGTTTTGGG
rJMSF051N01+ ACACGCGGACCCGGGGTACCCGGCTGGGATTGGGATAAAGAAAACGCTGATTGTTTTGGG
rJMSF045K18+ ACACGCGGACCCGGGGTACCCGGCTGGGATTGGGATAAAGAAAACGCTGATTGTTTTGGG
rJMSF006L16+ GAAANCGCTGATNGTTTTGGG
rJMFF046O14+ ACACGCGGACCCGGGGTACCCGGCTGGGATTGGGATAAAGAAAACGCTGATTGTTTTGGG
                      ____________________________________________________________
consensus ACACGCGGACCCGGGGTACCCGGCTGGGATTGGGATAAAGAAAACGCTGATTGTTTTGGG
 
. : . : . : . : . : . :
rJMSF019B13+ ATGCGTTAATGCGCTGGGGATGATTTTCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
rJMSF051N01+ ATGCGTTAATGCGCTGGGGATGATTTTCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
rJMSF045K18+ ATGCGTTAATGCGCTGGGGATGATTTTCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
rJMSF006L16+ ATGCGNTAATGCGCTGGGGATGATTTNCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
rJMFF046O14+ ATGCGTTAATGCGCTGGGGATGATTTTCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
                      ____________________________________________________________
consensus ATGCGTTAATGCGCTGGGGATGATTTTCACGTTCTTGGTGCCGGAGCCGAAGGGGAAATC
 
. : . : . : . : . : . :
rJMSF019B13+ GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
rJMSF051N01+ GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
rJMSF045K18+ GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
rJMSF006L16+ GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
rJMFF046O14+ GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
                      ____________________________________________________________
consensus GCTTGAAGAATTGTCCGGCGAGAATGACGATGAGGGTACCGAGCTCCAGGCTGGCGATGC
 
. : . : . : . : . : . :
rJMSF019B13+ CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTT
rJMSF051N01+ CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTTTAAAC
rJMSF045K18+ CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTTTAAAC
rJMSF006L16+ CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTTTAAAC
rJMFF046O14+ CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTTTAAAC
                      ____________________________________________________________
consensus CTACAAAACTGCCCCGGAAGCCTGATCGATCCAAATCGTACGTTTAAATTTATTTTAAAC
 
. : . : . : . : . : . :
rJMSF051N01+ TTATTATATATATTGTAATATATTTTGGGTTTGACTTTTCATCTCTTCTTTATT
rJMSF045K18+ TTATTATATATATTGTAATATATTTTGGGTTTGACTTTTCATCTCTTCTTTATTGTGATA
rJMSF006L16+ TTATTATATATATTGTAATATATTTTGGGTTTGACTTTTCATCTCTTCTTTATTGTGATA
rJMFF046O14+ TTATTATATATATTGTAATATATTTTGGGTTTGACTTTTCATCTCTTCTTTATTGTGATA
                      ____________________________________________________________
consensus TTATTATATATATTGTAATATATTTTGGGTTTGACTTTTCATCTCTTCTTTATTGTGATA
 
. : . : . : . : . : . :
rJMSF045K18+ CATATATATATACTAGAGCTCACTATAGTTCCTTTGGGAATATGTTAATATTGCGTTGTA
rJMSF006L16+ CATATATATATACTAGAGCTCACTATAGTTCCTTTGGGAATATGTTAATANTGCGTTGTA
rJMFF046O14+ CATATATATATACTAGAGCTCACTATAGTTCCTTTGGGAATATGTTAATATTGCGTTGTA
                      ____________________________________________________________
consensus CATATATATATACTAGAGCTCACTATAGTTCCTTTGGGAATATGTTAATATTGCGTTGTA
 
. : . : . : . : . : . :
rJMSF045K18+ CTTCAATAATAAATATA
rJMSF006L16+ CTTCAATAATAAATATA
rJMFF046O14+ CTTCAATAATAAATATATATGCATATTAATAAATTCGTATAAATTAAAAAATTTATTTTC
                      ____________________________________________________________
consensus CTTCAATAATAAATATATATGCATATTAATAAATTCGTATAAATTAAAAAATTTATTTTC